chaperonin containing TCP1, subunit 7

cDNA: Genbank AF506229

 

hi800a, 2191 and hi3979 are all in the 1st intron

 

cgacggcgacgagtcgactagagagttctaggtgcattgtgggtacctca

cccGGCACCGTCCTCCTCTATTCCGCAATCATGATGgtgagtgtgtacat

gcctgttttaccttcaaatcctttgtcatctgtccattttactttattct

tggtgttttgacataaaagcctggggacaatatagcataaagtacatgtt

tcttcgattatttttgttttcaatgaattcataagctgacgtttttcatt

gatgctagttagctttgtggctaacgattcattcttcaatttgagaatgc

cagtttgaattatgagctttgta

hi2191 (5-3)

ttgtgacc

approx hi800a (3-5)

caacgtgcaaaatgcgacgtctgtgtaataatgtgcacattttttttatt

atgcttttattttatttttttcttcggattgttttaatcgtataggttga

taaaggatgccatggtttagtttagcatcatttaggtaacgtcaatggag

aaagagctaacggtaatgatcttttacctttaaaacctcaagggttgttc

ctctcagctgtcactccaaaaaacgtaatggaacggttttttttctagga

caaagacttttttattacagacacacaaagatgttagcgatttttgctta

tgacagcaagttgtttgtatgacagcaagtcgtttgagaaaccctgaaca

g

hi3979 (5-3)

cctttaactattagacgctaatgtttttatgatttccaagtaacttttat

gaagcatatttaaaccttttcagaaaaaagtgatttacacacttggtaag

attataataatctgcataatatggagaatgtcagtattattatatatgtg

tactagtttggttttctcttaagagtactaaaattagttgtcattaaaaa

aggcgacgtattaatgataatgcattaattcttgaattttttcctacagT

CCACTCCAGTCATCCTCTTGAAAGAGGGCACAGACACCTCTCAGGGGGTC

CCACAACTGGTCAGCAACATAAATGCCTGCCAGGTTGTGGCAGAGGCTGT

GCGGACCACCCTTGGCCCCCGTGGCATGGACAAGCTTGTGGTGGATAACC

GAGgttagtcagcaattctgtattttaaatagaagtgttgttataactgt

aaagatataagttgcacattaatgtgatgccctgtcgtttaatgctttta

cagGCAAAGCCACTATTTCTAATGATGGAGCCACAATTCTGAAGCTTTTG

GATGTTGTGCATCCTGCAGCCAAGACTCTGGTGGACATTGCTAGATCTCA

AGATGCTGAGgtaagatgacctcttcatttttatggatttagtccaatag

ttttctagacacaaaaataacggaattagggctgtgtgattaatcaaa