WD repeat domain 43, like

cDNA: Genbank AF506230

 

hi2144 is in the 1st intron

hi821a is in the 2nd intron

 

tagctttttcgcagcgccagcgctgctgcgcatgcgcgctttccaattct

ctctctctcacacgtgtttcccgtGCAGACGGACGCACGCGGAACGGTAA

GATGGCGGCGGACGGAGGCCGAGCTGCGTTACCCTGCGCCTTCAGCCCTA

AATCACATCAGTTTTTGGCTCTCTGCGCGCAAGATGGGAGACTGCGAATC

TGGAATACCGAGAGCAAAACCCTACAACAGGAATACGTGCCTTCCGCGCA

TCTGAGCGCAGCCTGTACGTGTGTGACATGGGGTCCGTGCCGAGCAGTTC

AGgtaacgttagcgcacagcagtcgggggatgaggcctgttataacacat

tgcaccgttgctgtatcttcagctctatttagtggggtgtttttcacgaa

tgcgatcctaaaactgaactgggggtcatttagtaatgtctgttatggct

gtgttataagtgcgctcgtgcagtgcgctgcgcacatgttgagtgtggca

catgttcagaaacaggccgcgagctccacacgtcctgcacaaaatcacac

acaaagcattgaaaaagctctaagctgatgccagaacgtcgtttacttac

ccatacaggactcctacacttagtttatgcttctgctgagtgtctgtgcc

taatggcattggtagaataagttgatactgacaaaagtgatggttttgtg

taagttgttttgtaacaaaaagtatgtcaacgcgtgtgttcgtgttacaa

atgtttgtcgtttcagttatccgcgttttatttagagtgatttgagtgaa

atgacgaatggtcacatggcagtggtttacttgttgctgtttgataaatc

aaagatcagtacctaaccacttcaatacgatggaagtaatggataattct

gtcagaagattacattattaagctttgacaagtaactattgcatcgtgac

tagttacagacagcaaatgctgcatatagaaatcaaatattcacgttctg

ttttcacattttcttgttcagttgtttctggtactaattccaaagtttta

caattagtcaacattggtagtagtgactagatattaggaggagttgaaat

ggcttctctttgttttacagtatatgcacttgcactgtacataccct

hi2144 (3-5)

ggaaagcactgtgttatgccaagctctggaaaaatggaaaaaccttaaat

tataaattattatttagattagttaattgcagacaatagctcacaaaatg

tatattcagttgttttctgaccataaatattcaggggaagattgatagtt

ttgtgtatatacttaacattactcagttaatgtatctacaaatggtaaat

ccacattaaaataaaagttttgaggtggtctcttaatttattttttacag

ctgcttgtttatgactataatgggttcaggttaatttcaagttatcacca

aggtatcttaatttcgagtattaaaatactgttaatgtttttaaaatgta

ctttaagtacaaagccaatgcagaacaggtctgtcataaagtagtactgg

taaagtacagattcaggaagtcaatgccaaagatttgtctccaatatcag

tgtttgttttctgtaatgtgaaattactatcttatttaaaaactgttgtt

gaaataaaatagatactagcaagtatttgataacttaaatgtttcttagt

aggtgatgtggtttaaagttgtcttatcggaaattggtgaattgacgtgg

aattatttcaagtagaaaaaacttgtgttgaactttaatagactctgttt

taatgataatgtttttttgtgttttagGAGGTGCCTCAGAGGAAGAGGAG

GAAATGTGATGCGGCTTCATCAGCTGAGCAGTCAGATCTGTTGGCACTGG

GCACTGCTGCTGGCACCATCCTCATCTACAGCACACTGAAGGGAGACCTG

CATTGTACATTGgtgagaaatcatgaccattaattatagtattcatagcg

cacatctcaaagatttgagaggttttacttcaatttttccaaaagagata

atcaaattgcaaaataacaagattcttaagggataaa

hi821a (3-5)

gtaggtaatagatgttaatgatgatttaccataacagGATGGAGGACACA

GTGGGCCTGTGAACAGCGTCCAGTGGCATCCAGAAGACTCTGTGTTATAC

AGCGGTTCAGATGACACACACATAGCCGAGTGGGACTTGAAAACGGGGAA

AGTTTGCTGgtaagtgtttgatgtttgaccagtgtgggtttcttgcttta

tttctgttgttttaccctttgtgtattgttcaattaaataccatttcaat

atttaagtggctgtttttgcctcattaaatgtcattataatgaatttttt

ttaaatgcaaatccttgacagcatatacattctgccttggtggtggtttt

ctctttttggatgaggttaaatgtgtaatgttacggctgatcatcagtt