60S ribosomal protein L14

cDNA: Genbank AY648722

 

hi823 is in the 1st intron

 

agtgtatgatggtcgcgcatgcgcagcgctgaaacggaaggctcttcact

ccagagcggaagtgccctcgttCTTTTTCTACCCCGGTCTGCCATCATGg

tgagtgaactcggcgacgcagagaccaaagtttagacaaatatgatgttt

gtaaagagtttacaatggaaaaaagcgcgtggagggtgttttaatgcgtt

aatgaggagaggtgtgctgtttgtggagtgttgaagacgcgtttagcgcg

atcgaggagaattaagcgtccgagtctgaacaacgtggtggatgagggaa

cacaggcctcacacacacagaacacacactaaacaacaagctgtagattt

acaccacactgcaggtcaagagcgaagagcagacaccgcgtgtgagatat

gcggctattattctgatccgaacttaatatttagcattagccgttagcag

atctccgacagacggcatgctaacactcttcaacatgtctgaccagctca

gatctgataaatgcgtctgctagtgtcaagagaa

hi823 (5-3)

tgaagatattctcataataatgtgttattaatgtgactgctaatgctcgc

tgatacactcgcctgaacacccttcactatattgaggaatatcgccactg

acgggaaaatagtcggcttttccaataaatataacaactatggcatataa

gtgacttttggaatcgccagaaatgcactggatatgaaaaattcgtttat

gcaaaaaatattctgatcatgtaagtttcccactgtccacaagctccatg

tctgctcggtaatactcctgatttaacaactcttactgctgtgagtggca

ctaaagcaccccccccccccctccaatactagtgacagatctattaaata

ttgtttttatcaagatatttagtacatttcctactgtaagtaaatccact

gtatgtttatttgtaatgtggagcttaagttagatgattcttaagttgat

tttctcttatttctaatttaaccttcagatttttagattgtcagtatgta

tgtacactcaccgaaagcggaataaccactttacattactgtataaatgt

gaatgttgtttaattaaaagttacaagtttattgcaataccatttaacac

cttttaaagactccatgttttgctgattgtaagcacggctgcaggatgtt

ggagaaatctgacattgcagtaatctattattgtgcgaacgtttctctgt

aatattatatgaatactgtttcaccagatgcctatttctatctgcacaga

attgatgatttctgattgagcgtgacatatcccataatgcatgtgtgatc

tctctaacgcatgtgcggtatgtttcagGTGTTCAAGCGTTTCGTGGAGA

TCGGCCGCGTGGCCTTCATCGCTTTCGGTCCTCATGAGGGGAAACTGGTG

GCCATCGTGGACGTGATCGACCAGAACAGGgtgagtccagcacagactga

ccctaatgcactgtatatgatactcacgtcactaactcgtacttctgttc

ttatc