CCCTC-binding factor

cDNA: Genbank NM_001001844

 

hi870 is in the 1st intron, before the ATG

 

aaaatggacgagtcgagatccacaattactgaacgttacaaaaaagaaaa

aaagagcccacatccgtaattcaaaagtagcgccccacacggccaatccg

gacactgcctgtgtttacagccctccccctcgccaccgcccccctgcttg

acgcgcatgcgcaacagtcgctaagggccgccattttgtgcggagcctac

tCTGCAAAAGCGGGAGAGGATTAAAACCGCCGGAGGTGAAGGACGCAATT

TTACTCCGTCTCGTACTGAAGGAAGAACAAACCCTGGGCTTTCTGTCGAA

ATCAACGCGAGAGTAAATCATCAAACGCAGgtaaaatagcactacttttc

cgaaaggggggagttttgcaggagctttaatcggcctctaggtgtcacga

tggggctcccagtccaggcggctggcggggggtgtttgtctccctctatc

gttatcgaaaatttagcaaaaaacatttataacccagaagttcgggcttc

agtcctattattaagcactatttaaactatatcagccggcatttcgccga

gatgccattatttaac

hi870 (5-3)

gtcaggatgtttgcttcaatctttaggccaggcgtccattttctgtttct

tctctttgtttcctgtctttagaaacccgccgtttctgcacgcgcactta

gccaagaagctaacgtgtccctgaaagttaacagatttccagtcctgcca

cacccaaaacggcttaaaacataagttgtgcatccgcaaatgtgaaatcc

ttagtgttttaagcggaaagtgtccggtttttggtagtaagccacgtttt

agtggcgcccatcgccgcgttcgcgcccctcctcgagcagttaaattcaa

acccgagccgatgaaacattgacccggttccgcgagaataaagtcccatt

actgcggcctccattcgctccttggtctttatcgctcatgtaatccgaaa

tatcgcaacaagcttaaaaataaacgcatctttggtggttacagcttcag

ttctactgcctctgctaacgcattgcgcagattaaaatcaaacgaggaag

atgcctttgctaaatgacaccgatggccattttcgataactaagaccgag

tctcgccgtgctcttcccgaatcccggagtttatcacctaaaaacagccg

cagttgtcgagctcggtgcgaccgctcgctcttattgaaagactaacctc

aagcaacaaacgactgaagggataaaaactgtagagagctccctctacaa

cccgactggtagtggtacaaaaacacgattaaccatctcagaatgccctc

ttgctgtggaaaaccataagggtgttttgaaacgtgtggaggtaagcaca

gtggacacagttgcaccgttttgtctgtttattgtatcggtggccaaatg

cgcgcattcatgaggaagtagaagagaatcggttcagatgatgctttctg

gcgccgaatcaagagttcaaaacctggctttgctataatgaaagtcacat

tcaagttttgcaagtttttggagattttgcgcttatatttattatactta

tggttattatatttatgcaaaatgtaaatggtaaatttttatttttacac

gtctgtgtaaatgtttaatgaacatttatgtgagatgcgctgtgtgcgat

ttaattaacattaaatagcataaatgcggtgtgatttagctttgacttgt

atgaagtgttagataagtgtgggttattttgcactttgcttgattttttt

gcatcccaacaggttgagtcaggtagtaagaagcagagttaaggcagata

ggtcattcatcggagacagaaagtggtcgaggcgcagtggtagagagatg

aagtgttccatattggtgcaggtaaactcacagtatactgtacaaaaaat

gaggtaaagttggttttaaatgtgcacattcgtttagtgacaacttgtga

cattctccatatattgtttaccatggtactttggaatattcagcttgaaa

tcacatgcaagtattacttcaaaacattagcactgtttatatgactggga

acgatggtgtactttaatggtcatttggctgctaatttgatttcgctatt

tagaatttgcaaacaacacttttctaatattatattattaagaagaaagt

atgaatgtacaaatataaaaccaactttacctcaattgcacaatcaccaa

aaccatggatgtcttgggaagtgcaaactcaacgctgttatataccagtt

gcaatgttgatagcagcctgtctcggagcgagtaagtaaatgcagttgag

attgtagacaggaaggagaaatttcctaaattctgtctgctaatttgtga

ttttaaccaatgtagGTATTACCCATGGAAGGGGGACCGACTGAGGCCGT

GGTGGAAGATGCAGGGGATGCTTTCAAGGCCAAGGAGTGCAAGACATACC

AAAGGAGGCGGGAAGATGAGGAGGTGGGAGCCGAGCTGCTGCAGGCTGCT

GTGATTGAGCAAGCACAGGCTGAAGTTGAGCCTGTGGTGGAGGCCCAGCA

ACAGCTGGTTGAGAGTGTAGTTAGTGTCAACAGCAGCGTGGACATGATGA

TGATGGAAACCCTGGACCCTGCCTTGCTGCAGATGAAGACAGAAGTCATG

GAGGCTGCCGTTGGGGCACCTGTCGCTGTGGCTGGTGCTGCTCATGAAGC

CACAGTCACTACAGTCGATGATACACAGATCATCACCCTGCAGGTGGTGA

ATATGGAGGAGCAGCAGTTGGGCTTGGGAGAGCTGCAGCTGGTGCAGGTG

CCTGTTTCTGCTGTGCCTGTCACTGCCGCCACCGTGGAAGAGCTGCAGGG

GACACTGGTGGATGCAACTGCCATGCCTAAAGATGGGGAGCCGGTCATCT

GTCACACCCTGCCATTGCCTGAGGGCTTTCAGgtttgtgatctgttttgg

ttgtgaatagatggtatgttttaaagggaccaccttgtgaatcttaatgt

tcttttctttttcagGTGGTCAAAGTGGGTGCAAACGGAGAAGTAGAAAC

TGTGGAGCAAGATGAGCTCCAGCCCCAAGACGATCAGCCTCCGCATCAGG

AGGAGGAAGAAGAAATGGCTGAACCCCAAAATGAAGACCCCGCCTGGTCC

AAAGATCCCGACTACACACCTCCTGTTAAAAAGGTCAAGAAGACGAAGAA

GAGCAAGCTGCGTTACAACACACAGGGTGATAAAGACATGGATGTGTCTG

TGTATGATTTCGAGGAGGAGCAGCAGGAGGGTCTGCTTTCTGAAGTCAAT

GCTGAGAAAGTTGTGGGTAACATGAAACCACCCAAACCAACCAAAATCAA

GAAGAAAGgtgagtgtgtgatatgttgctgaacgaatgattcgcggcttg

tatgatatcaatgtcagatctgctttgagctaaatcatttgctttgtgca

gGAGTTAAGAAGACATTCCAGTGTGAGCTGTGCAGTTACACTTGCCCACG

CCGGTCCAATCTGGACCGCCACATGAAGAGCCACACAGACGAGAGGCCTC

ACAAGTGCCATCTTTGCGGACGAGCATTTAGGACTGTGACTTTGCTGAGG

AACCATCTTAATACCCACACAGgtacataccctggagtattacagttagg

tataaaggtctttgagtttctagataattaggaa