translocase of inner mitochondrial membrane 23 homolog

cDNA: Genbank AF506231

 

hi887 and hi3198 are both in the 5 UTR

 

ggcgacgagtcgaagcttcattttccaacttcttatcaagacaaaaatgc

ctgtttatgtttgtagatctttcctcatcccttacgtcacaaaacacggt

tggtcgcaaaaggttctttaactaactggtgaataccgtgtctttacagg

tcatataaataaaaacaacataatttgacagcataatttacaatgacaca

ttatgttttatttaatctatatgtgatacgcgtttattttactgttctgt

aatcacgcgagtaactttacggcagtgttacgtcagtggtgtcctttcgg

tttgcGGCAGGGTAGCATGTGGAGGTCAGAGATGTAGAAACGCTTCGTCA

GAGAATAAAAACTTTAATTATTAAACAT

hi3198 (3-5)

CAGCGTTTGATAACTCGACATAGTGTC

hi887 (3-5)

ATCTATGCAGATTTACATCAGACATTATTGAACACAAGGCTGTCGGTGAA

GAGATTTTGTGTGGATAGTCTCCATTAGTTTGACGCGGATCAGTAAGGAA

GAATTGTAATCATCGAAGCGGTATTAACTGTATAAGTGAATCTCCGAAAA

CATGGATAACAACACACCGCCACCGGGAGGATTTAAAGGAGGACTCGGGA

GCATTTTTGGTGGAGGAACCCCTGAGTATTCAAACACTGAGCTTTCAGGA

GTACCGTgtaagtgttcggtgtttaaagtttaacctaatgttagccaata

taacctgaatatgtttatgaagtattcttttctgataccgtgtaacttga

atggttgttaccctttattcacagTGACTGGAATGAGTCCTCTTTCCCCA

TACCTCAATGTTGACCCTCGTTACCTCATACAGgtgaggttctggaaggc