taf7

cDNA: Genbank AF506232

 

hi889 is in the 1st intron, before the ATG

 

tcgaacccgggccgcctgggtgaaaaccaggaatcctaaccgctagacca

tatgggacgatactttactacgtgtttttttgactattgatacatcagca

gaaatcctggtcccttgtgttgatttcatatttatcaagcgtttagtaaa

gcaattacataagcgtcatattttctgggggttgtgtaagcagactttag

catttgttagagtattggcgtggttttataaaagttagctgcttctacaa

aacggacatatctatgcaaaacggacagcaggtggcaGTGCAGCGCTAAA

ATACGCCGAGCTTCCGCGAGACACTTCATAGAGGCACAGCTATGTTTATG

TGCTCAATTTAGCTGTTCTCTGATAACAATCATATTATTTACTgtaagta

ctggaattaatgttagcattactattattactactgcgctctgtattgtt

tcaagaagcgaatatttattaaacaattacgtcaacgatattcgtgttat

atataa

hi889 (5-3)

taaggctaatgttagcttcgcatatgtagcattagcctgtaagattctca

caggattttggtgagtatgtttattaacagctttgaattgtgctacatta

ttagtattttatcactcgtagataaacacgtttttttaaataatactttt

ataatgtatttaaacgcctgtagccatttatatgcggctgtatacatgta

ttgtattatattctatttctttgcagAACTAAGAGCCAAAGATGACCTCA

AAAACAAAAGgtacaaatatgcacgcactcccttttctattgacattggg

gtattactgtggtattaccatcgtttgaactcgtaaaacggtaataagta

ccatgtaattacaactacatgcaagtaccgtggtacatggtcatgctaat

catttagtacgtatgctaacgttatattcctaagtgtatttattaacatt

taatacaaattattggactttatcagtttattttatgaataaatatcaac

cagtatgtaacattttaagttgtctctcttacagTGGGAAAGGTCGGCAC

TAAAAGCAAAGAAGATGCTCCTCATGAACTGGAGAGTCAGTTTATTTTGC

GGCTTCCTCAGgtcagtttgtgtcctatattaggaaaaaaagtcactgga

caaatgtacatactttaattaaaagtgtttgaatacttgtgttctttata

gtgttgtttgtaggcatgagccagtaatagtttctgatggtataatcttg

gataaaaatatcacggtttgaccgtatggtgattactgctttaaaatata

tatatatatatattttttaatgtctggtaataaaaacatttttacctttg

aacatgatctattttaagcatttaaaatatttttggaacagtaaacatgt

caggctaagtaattaaattctgctgtcttaattagttttaagaacatgaa

gtaacacagatctcgactcgtcgcc