spinster-like

cDNA: Genbank NM_153663

 

hi891 is in the 5' UTR (or possibly in the 1st intron, before the ATG)

 

 

gatcatcgtaaacttaaaaaacgtattgttagtatttttaataagtttta

tgagattcaacagtaagggaaaatctacaaagaacatattaaatctgcga

aaactcaataaaagctttttttttttgtataaaaagtgtaaaatgttcac

aaaagtggtacgttttcgagatgttaacaattttgtgttgatgcttgtct

gaggagggaaggagaggaggggcgtcacatgactgtgcagcggaagccct

gcgtcatcataccaatatggcggtccgtgctgaagcttgttaaattcaga

AAACAAAACTTTAAGTCGGTCGGCTGCACGGTTCGATTCAAGTCTCTCCA

CTGCAGTACAAACATGTTCACGCAAGAGGTTAGGTAAAGACAGCCCGAAA

CATCTCGACATCCCAAAACGAACCCGACAGCGTCCACAGAAGAACTTTGA

approx hi891 (5-3)

GGACGCCTCCGACTTCGCTTTGCATTTTCCAGgtaaacaacagtgtagat

acgaggactgttgggtgttaaccgatttctaaataaatgctctggtatat

ctgaccggagatatatatcgctcttttaaatttgtttttgtgatgtctgg

atgtatcttgtaattaaacgttgtttcttggctgttataatctaatgttt

tgcttttttggttatgtttatatgcaaatgtattcgtttaaaccaatatc

acaacagtgatagcgtttctaagccttttcctacattacaagaagggtaa

aatataactttaatgttggtgtctgggatcgttgccagtcaaacatgttg

cttaaccagactgatatttgtcaacagcagcatcacatgtcagcagtcag

caaaagccgcttcagcttttagttggattcagctgacaatccgagatctg

tcggtttactgaaagtagataaagagtattctgacatgttgtccattata

tgttgagattaaggtgaagttcattttatattcagactttctccttaata

aaatttcacaaaaattcaaattgtaaatgatgaaatcatattagcagcca

atgactatcaaagcacaacattggctagttaattaaatagtgctaatgtt

gttttcaagtcatccatgagcagttccatgcaaatgtcaaccttgccatg

aaaacaaaaagttttcaccaaaatatcaaaactgttttctatgtttctta

ttgtaagcaagtgatttacagtactttggtaaatcaaatataatagttag

aaatcattgacagttgggctgtgcgattaatcggaatctaatcgcaattt

gaaacgttgcaattagttcaatcgcaagtggctgcgatataacagaatgt

atacaggaatcagagtaatattcaataccttttctgacctttttaaagac

tctttccgtacaatgtaaggccttataactaggcccacccggaatctgtg

cgcgcagaattccgtagattttccgctgatttttagcccatcattaactc

tgtttattcacttgagtaaatgtgtgtaaatctttatttattcagttttt

taattgatttcagtaaaattattgactgtgaaaatcttcatctgatttat

gtacaatacagtttgtaaagtcatattttctgtcttttattagatatatt

atatgacagacttgttttatttaccaaataaagtgtatctaattggatta

gcattttaaacattaaacagttaaaaagatataattttttatttaatata

ttaaggttttagttatgacactcacaaaataatttaggagaaatctgcag

acttttattcaaattctccgcagacatagcaaaaaaacgtcctcagattc

cgtctggccctacttataaaacaccagcgagattttaacttgcaatatat

tttctaaatattaatgtaagaaactaatccaaaactaaaacattatttat

ataccaaataaaacctatataaacgcctatagacctgcagaaataatggt

gttgccttggttactgcattaaacaaagcagcatgatgtaaaattgcata

ccttgcataatcaaaaactatttaaaatttaataccttgcaaaatagcat

ataagactttttaatactttttaagggtcttaaatttctctatattgatt

gatcaacttttaatactttttaagaccccacggacacccaccatcaacta

tatttgtattattttatttcccccttcttggctacaaagacaagtcttac

tagccaattgagtgagcaaactttcattctgcccaatcaaaattgtgcga

ctgaactatgcggaacgcccacaatagaaaaaaaacaaacaaacaggaaa

gtgcggacgagtgggataataatgttgctgcttcagaagcattaatagag

gaattaatatcaaagagaaagagcgttggtaatatgggactattttagtt

tcaaactcgcagacacaaaaaaaaatggtaattttaaggagctattgcag

aattgttgtcacagcttacagattatttagctgaagcttgactacaaaat

taaaatcgcaaatcaaatcgcaatatctgtcaaaaatatcacaattagat

atttttcctaaatcgcacagccctaattgacagagacatttttaagtatt

tatagacacacaagtggcaatttcacatcggtcacatccatagcggagag

ccgtcccatcctcgacacattttttcccctcataaatgcaaaaatataaa

atataacaaaatcaatagtttttgttagagatccaactcttatcttgatt

atcattgtttcttttgggttgtgcggtttaattcttaatttctacaaagc

atgttgtatactgcaaatactattttggtcacatccataacgtatgttta

ttttctttatttaaagtacaaaacatgtttacagattgatatttttctgg

tcctttaactctgtaatgagttgttttggaaaacataaacagatgtttca

gtataatgttaacatgtatactttctatgtgaatttatgttttgagtttt

tactgcaaatgtcgcatccataacgctggaaatgctcacttgcatctgat

ttcagagcgaatattcaaagtaccatggtaaacaatatagggagcatgtc

acaagttgtcactgaaccaatgtgaaccaactttaccttcgttaaattga

gtgggtctggcttttaactttcatttacttatgcaccaaaattttaaatt

acgattttaattaaatataaacatgaacttttttctaatcaaaatgatac

actgcttcttaggtccatagagtatgtgttcctcaacataaagtcttcat

tactgtattcacgtgacattgtggagagattaattggggtcacgagcttg

tggctacttccctctctgcgcatcttcctcttgcaagaattgttattata

cagaaaactgtcttgtacattctgctcataatcgactacaatgataaata

acagaatttagcagtcttacatgctgacttacatacttaatgaatgtgaa

agtctgaaaccaactttacccatcctctgaccagcaggatttaaagttta

attcatttatactgttacagtggaatctgttttggaaaaatgctctagtc

aataaaacaaagagctctttgatagtactgtaaatggattatctcacaca

gaatttacagtgaggatcaaaaattttagtctacatttaaaatctctaaa

tctctcttttaaaatattaggaatgtatgcatgtaaatgtaacacagagt

aaatttgggcaactaaatatttcagtaatattggataaagtgttaatgca

ttaaacccgtttaccgtagttttatcagtgatattcaaacagaaaaatca

cttcaagatactttttttttttttttttggagtgtttctgagtttttatt

tatttatcttatttgtatattagagtttagtcagtaaaaaggccaattaa

ttaaaagcctggcataaaatgtaaaaaaaatatttttaaaaaattaacta

tttggatggcattaaacaaataatcattttttaaattctgtagatatgtt

tcaagaatataatgaatggaaaatctttttattatttgtttattcatttc

cacaggtttcatccaacatttgaacttatatcctcgtgagcttgagatta

gagtgtgatcaataatctatgtttgtacactttgatcttttattgctctt

gagcacttaacatcactctttagctttgcttcctttaagcatatatgatt

gtgttagatcaaaccaatagttttattatatttatttctttattttttaa

ttttatttattataatttttttccataacttcaagattttgacttgtacc

atacatcataatatttcttctgcctcatccttgtctttatttttctgcag

CAGTGATGTCACAAGCAGATGCAGACATCACGCCCTTCTTCGCTGATGAT

AATGAAGGGGAGGGGCCTGTTGAAAATGGGGTGGGGTCACCTCTGCCTGA

GGACGAGGAGGAGGAGTCTCCCAGCGGAGTCACCGATAGGAGAGCCATAA

TGACTGTGATTGTGCTCTGCTACATCAACCTGCTGAACTATATGGACAGA

TTCACTGTGGCAGgtaactggtgctattagacggtgta