mind bomb

cDNA: Genbank NM_173286

 

hi904 is in the 4th exon

 

cctcactgcccactagcgttttggaagtgtttatgcagacttcgcagact

tgttaagacgccggtcacttgacgcagaagtataaaccaggctttagtgt

agacatggccagagttaaatccaaacccgaaccggaagttggaaattttt

aactttcctttcgaaaaaagagcagcttaaattttttttcttataatttt

gatgcaagatgataaaatccgtacataaatacataaataaatgttttttt

tatttaataaaatctaaatattaaatactttaaaggatttaagatgctaa

tgaccattaaacgtgtcttatgaaaatgtccatagtgcatcatttgggac

actaaatcaagaggttcattaactcttttgaaggttttgtttagtcagta

atcactacagctacttttcttttctctcataaactgtccatttcagGTGA

CGGAGATCCAGGACTGGAGTCT

hi904 (3-5)

GCCAGCCCCCACAGCGCAGCCTACGTCCTTTGGGACAACGGGGCCAAGAA

CCTCTACCGAGTGGGATTCGAGGGCATGgtgagccacccccattcctaca

cacacacacacacacaaaagactgcagttaacaggcctttgtgttattac

ccacccccccgtcctacccaacactgcaccacacgcaggccaggcgtccc

ataagctggccttctttataaggggcagccattgtgaagggcagctggat

gagctatctgcatgataaaagaagtctgttggctttacaagagagcaaga

ctcgacaccaagaccaaaagcgtgcctcagttgttgaaggccgccctttg

attggctgatccactttctgcaacatctgaattccagccaatggctctgc

ggatgcgctccggcttttgtctgtgattgcagtgtgtccggagggtgtgc

gcaccatctgccactggaattattaattagatctggatatagaggaagat

atataaggaggaatagagacgttcaagtcatctggtgaattagtactcat

gtcgcagaaacactaaatatcacaatatcagatttgtccaatgccatgca

gccataatcagctgtctgtttctgttttttcagTCTGATTTGAAATGTGT

GCAAGATGCCAAAGGAGGGACTTTTTACAGAGACCACTGTCCAGTATTGG

gtaagatttaaaatatctgatattaccaaaatataccatgccggttcaat

gaatatacagtgggggaaataagtattgagcacgtcaccatttttctcag

aaaacaaatttctaaaggtgctgttgacttgacttttcaccagatgttgg

taacaaccaaagaaatccatatatgcaaagaaaacaatattaattcattt

actaatgaacttttgtgttataagatgtaatgacaaagggaaaaagtatt