ATPase H+ transporting lysosomal V1 subunit

cDNA: Genbank AF506234

 

hi923 is in the 1st intron, before the ATG

 

 

tcctcatcactagcaagaaacatttctttaaggggttaatcctatgcccc

gctcacatgacaacatcacgtgacactggtcccgtgacgtCTTGTTGCAA

TTTGACAGCAGAGGAAGCAGgtaagcgaagtcaaaaatgtttttttttat

atttctgttgaagtatcgctggtcggattcaacaataattgttagataac

tatttagcaacgtcgtagtgaacgtagacgcgtggcgcttcgtttctaac

tcgctgttttcgtgcattagcatttgtcagtggctgtgttcattcagtaa

cgttagttgttttgttagacaacagtacaagatatcgtcacacgatttaa

aaatg

hi923 (3-5)

ccacgtttacaacgttacttaaagacatgtttggttgagctcaatacagt

atacattttaaatgagctcgtttaattcgctttttagccgtttaacctta

gctagcaggtaacgacccttgcgatgctagattaatttaatagaccgtta

acgttacagctttataacaacacacggtcacacaatatacgtgaaatctt

tattcacgattccttcaccgtgttaaatgtctttcctcttttcgtaactg

aagatgctgcattatttgttatcgtggcctttacagatttagcacatcac

gatttgatattgtgtttatttttaagcTCCTTAAATATAAAATCTGAAGA

TGGACATCCGAGGGGCAGTGGACGCTGCCGTCCCCACCAATATCATTGCA

GCGAAGGCCGCAGAAGTCCGAGCAAACAAGGTCAACTGGCAGTCCTACCT

TCAgtgagtacatctaaatatcacttctgcttctgtatttctctcataga

cagcctcgatgctctatttgtagggtgctttaggtttggttttaatttgg

acattctgaggaaattaagagtgtctcaaaacatcatacaaataaaaggt

actcatgtgaataaagtggaaaacgcttgatacatagt