eukaryotic translation initiation factor 2, subunit 3 gamma

cDNA: Genbank AY648723

 

hi969 is in the 5' UTR

hi929 and hi3689 are in the 1st intron

 

aacatataaatcattaaacaaacagccgtttcgcaaataacaaccactga

ttgtgagtttcacgaataacataagaactacaaaacttctgacgtcatta

taataagacggacccttgtttcatcagtatcagcccaacgtgttttcaag

tttgctgacgttaatcacaattaggtaaatcgtgatatttgtatgttgct

gctttcattttatttgttacccATAGTTTAGAATGCGATTTCCGGTCTAT

CTTCTCTTCTTGGGATTTCCTGTCCTTTTCTAGAATCGGATTGCATCATC

CCATACGTTACCTTCTGGACGCCGTTAAATATATGAGTTTATAATTATTT

GTCTC

hi969 (3-5)

ATTTAATGGTTTGATACAGTGTAATAGTAAGAATTACAACTTTATCTAAC

TTCATATGACCGAAACTGCGATGTAATTGCACAGAATATTATTTAATCGC

ATATATTTATTTGTAAAAAACGGTCAGGCGCTTGCTTGGTCATACCCTCA

TTCCTTTTCTTTCAAGATGGCGGGCGACGAGTCTGGAACAACGTTGGGTC

AGCCCCATCTTTATAAACAAGATCTCAGTACACTAgtaagtctgcatctt

gtgttcatttaggtaatatgaaatgatctagatgtactgt

hi929 (3-5)

cttcgtcgtcagttcgagtagagcggttttgtgctctctgatgaaggcag

gcgtgctggttagcagtaccggtgaaagctcaccacatgattcattcggg

gatggagaaggaccccgtgtagaaattatatgaaaatatcgtta

hi3689 (5-3)

aaacgttgtttgtcatttatatcgtgctgttattttcaatatagttccaa

ttatcgacaaatgtggttgaattaacttctaatcaattcttcattgacgt

ctcgtgtgatgtggttgacagtacttagatgtttcattaacgttatgcca

agctccttatcttatagttatcgttaaacgatggagtatttatattttta

ctgtaattcactttttaaattgtttgtcagtctaaccgcgaattcctttt

ttatcattgcaagctacactctgagtcaaaagctagcaatagcaattatt

tgattcaatttaagcttgcaacagcaaataacagcttcccttctctaggg

taaaaacatttttcccctttcatagaggctgttacaagttttaaactagg

gctgagtgaataattgaaattgaattgtaactttcattatcatgcacatc

ttgtcaggaaaacaatgttgtatggtcagcagtgggcactctctgttgca

gacactccaaatacgccgcaaagtagtaactagggctgggcgattagttg

aaaagtaaacgaaattgacattcagaacctataatcgatctaatttttcc

agaatcatttagaagtaaactgataattactaattccacaaaagttagtt

tttcttttaaaaaacttttaactatttaatgggcactttctggagtgtta

cgtggggttattacaaggctactgaacaataattactttcttatttagct

ccttgtctgataaatagttaatttctactaagtacatgaacatcaatatg

tatttatatttatgtaaaaattatgtcgtttttgttctctcattcagaat

cgatcacatcacacagttttatatgcagcagcagctcttaacttatattt

ctgataagcagtttgcaattctctttttttaatttgtactaaagattggt

attaaaagattggttttgctttgtagGATGTGAGCAAACTGACTCCTCTC

TCCCAAGAGATCATCAGCAGACAAGCCACAATAAACATAGgtaagatttc

ttttttttctgttagattctggttggagagcaagtcaatgtccaaatatt

aattaattgtacctattgatttgtctgtagGAACTATTGGTCATGTAGCC

CATGGAAAATCAACAGTGGTGAAAGCCATCTCTGGAGTTCACACTGTCAG

ATTCAAAAACGAGCTGGAGAGGAACATTACAATCAAGTTGGGCTATGCTA

ATGCCAAGgtgtgtatgtcattcacaaagctaactataaaaaatattgca

agctacactctgagtcagaagctagaaatagcagttatttgactcaattt

aagcttgcaacagcaaattacagcttctctttttagggaaaattgttgtt

gttttttcacctctaagagaggctgttacatgtcattgcttctgaaggta

aaagtgttttttccccagggtttgatttatttagattgttgtcatgtttt

cttgaaaatgtgaatcttttacattgatcttgtgtatttagGTGTATAAA

TTGGATGACCCAAGTTGTCCACGGCCGGAGTGTTACAGGTCTTGTGGCAG

CAGCACACCTGATGAGTTCCCTACAGACATTCCTGGCACCAAAGGCAACT

TCAAACTAGTCCGgtatgtttatttgtgtgttat