HEAT repeat containing 1

cDNA: Genbank BC055128

 

hi3028 is in the 1st intron, before the ATG

hi932 is in the 3rd intron

 

gaaaatgcctataacatctagtgttcctatagtgtaaatatatcaaagct

cagttttgattacttaaatattttctttatatttagatttgtaccctccg

aatttacaattaattcataaatattccttcactttaacgttactccattt

tatttatcaggggtcgccacagcggaatgaacctccaaattatccagcat

gtgtttataacacaacggatgcccttctagcttaaactcagtccagggaa

acaccaactcactcattcacactcacacactacggagaatttagcttatt

cgattcacctaccgcatgtctttgggcgatgggggaaaccggtggaaatc

cacggaaacacaggtagaactcgaaccagcgaccttctttcctctcctaa

caaagtacacaacttatttagcaaacttaaagttttgtggttcagcagta

aacgtgcttgtatgaaaataccgattaaataaaaaatacaacaacgttat

tttgactgatccctgctttccctccgatgcactagtggcagtacaacaac

aatcgatttgtccgctaccaaaagcaaaacaggcacgagaagcacactGG

CACACTTGCACACACGTGGATACTGGTGCGGTAATAACTACAACCAAAGg

tatggaagtattcttacagttgtatctggacgcatagaaaatatcat

hi3028 (3-5)

aacacttgatcgttaattatttcgcgcgacgtgtataacctaacgataaa

cacagaaagtgttctaggctagcaacacagactggcaacatcgctctatt

taatgctaaacaaatcatttgaataatttgaaatatattcttctatgttg

tagtaaatagtcaatgcaagtcgtactatttatttgcgtgtgtatttatg

tttagctgttattgaggtaaagttgttttttgtattcgcacattcagatt

ctctccttatattgtttcagaaaagtaatatttgcacattccgagtatgg

aaatcatattagcaacctctgactataatgtacaatgttttggttgtctt

aaaaacaatattgcaatcacaaaataaacaacaaaattcaatgaaatgtt

tatgaactctatgtaagacataacttacatacagacaaacatacatacat

acatataacgttacatcaagttttaaggttctgaggatatgataatctaa

gtaaaaaaaagtcactgtcactatttactatatcaatgtttactctccca

taaaggagttcaaacctttatatgtttatttttctctgttgaacacatag

aagatattttgaagaacgttggaaaaaaaatctctaaccattgacattca

tagtaggaaagagtactataggagtcaatagctaatagtttcttacattt

ttctaactatattttgtgttcaatatatatatatatatatatatatatat

atatatatatatatatatatatatataatatacttatattaatagtataa

cagattggtttagcaaaagttcattatatcttagtattggaaaagcaaaa

gagctatgtctggagagtcaaacaagagtagcagatactagaatttataa

accagtcatcataaatggaaaaatagtaaagcaggtctcacgttgtaagt

atttaggcacaattattgacaataaactgaattttgacagttatgtagag

gctgattataagaaggtgtttatattcgcacagtcagattctctccttaa

tattgcttcagaaaagtaatatttacacattccgagtatggaaatcatat

tagtaaccattgactaaaatggtcaatgttttggttgtcttaaaaacaat

atcgcaatcgcaaaacaaacatcaaaattcaattaaatgtttatgaactc

tataaaaggtgtgcgtgtgtgcatacatacatacaaatatatatatatat

atatatatatgtacacacacacataaagtcgtaaggttctgacagtatga

taacctaaataaaaaaataataataattacggtttttgcagtattgtgat

tactgctttaaagtaggttctttttaaatgtctgggtaaaaaaaaaaaaa

acgttttccccaattgaattcaaagtattttattttaagaaacatttaac

ttattttggaacaggaaacatgtcaggataaataattcaaataaacagtt

gactcctgctatcttctttatagtttcaaaagcacttagattgaaatgac

aactttgtatatctttattttctttggatatagagtaagtaatgtttacg

tctataatatggttgaatgttggtgctggtgaataagcaatttgatttta

aaatgtttcctgaatcataggctaaacagtaatttttgatacctcgtcct

tttatgctggagagataccgttgcgctaaaaactaaataaaatagtcata

aagaacacctaaaagcttttacagatactgtaggaatggtattactggaa

attttagcggttttaaaactttcaaaccgtggtaaaccttgaaattggtt

ttcatcccatgcctgttttggagttaaatatttcctttgattaatatgat

gtattcgtttgtgacatttacatactgaaatcacagtaacaaaatataaa

ctgtattatcattcgtgtgtagATGACATCGTTAGCGCATCAGCTGAAGC

GGCTGGCCTTGCCGCAGAATGACTCGAGTCTGCTCGGCCGGAAAGAGGTG

GTCTCTGTGCTCTTTGACCCTAAAGATGCAGCCAGTATGGACCGCAGCAC

CTTCCATGCACTTGgtgagtaatcatggggttttcatatgtttctccaag

actttaatttcccttatttcaccctatgttttatctttgactttaaatgt

cactttttgctatgtcaatgtttactcttccctaaacgagttcaaacctt

tataagtttatttttttctgttgaacacatagaagttattttggaaaacg

ttggaaatctgttactattgacattcatagtaggaataagtactatagga

atcaatagctaatagtttcttacatttttctaaatatattttgtgttaaa

aaaataaatagatataatttacatgtattaatagtacgacagattggttt

ggcaaaagttcattatatcttagtattgggaaagcaaaagagctatgtct

gaggagtcaaaaatgagtagcaaatgctagaatttataaaccattcatag

caggtctcaaattttaaatatttatgcacaattattgacaataaactgaa

ttttgacagtaatatagaagctgtttataagaaggctagttagcgtctct

gtctcctttgcaagctgagaagtgttaatgttatcacacagactttaaac

atagcatatagatcatttaaggcgtactcacacaatgtacagttgccttg

atccagcccgcactcacattacattcgagcctgggcacgcttgcgtcatc

aatgatgcactgtccagtaagcgcttttgctcagctcagtgaagatttct

taagttacatcgttttagtcgtttgggatgcggtgaaacgttgtcaaata

tttcgctgaagagatcagccacttttaacgctcattaacaaccataaagt

ccttgtgctgcacgaattaggaggtttactaaaggtgcagctgtcatgca

gtgaggagtttgcgtctttaataatttacgacagtttgcgttcgtttcac

agaaagaatgaataataaaatccgtttgaaacagtcctgtaaaggtcacg

tctcgtcttcagtatggggctcatgcgcacttgcactcacactaagtgaa

ccgggctctggcacacctcttccaaccgggccaaggccagccaagttaac

cgtgcctgagcccgattcagagcactagtgcctttagtagtttgagtagg

ccctgtgagtagtaacctagtgtgagtaggccctaatagtgagtgttctc

acgtacaatattatttcatggtttggttatagaatactagaaattatcgc

aaatgattagggatgcacgatatatcggcgcccatatcgttatcggccga

taaacgctttttttaaaatgatcgttatcgatccgatgtcataattaggc

cgatatatttaagccgataaattacgtaattttacagacctgcgtgtcgt

gctcgcgtgggcggaacttgttcagacttgtccagtgcactctaatggag

ctctcccacattgtttattccttcaaagtctgtcctttcttcaggtgaca

ttgctgtgcgtttataactcagtaagtaaccacgttccttatcattgtag

atatgtttgattgagtgtcattaagtattttgctttaaatcgccttagga

aaaatattacatgtgtaaacctttcctgctctgtctctttgttgtgttag

agagatcaggggagattcacttattagctactccagggccgaataatatt

agtttcgggggaaactctttttcattgcagctggtgaataaaagaggaca

catgtaacttggtccaaaatatttattactttccgtgtggtacaacgaat

aagtcaccaaagagggaacatcacagaaaatggtctcattgcgaaaaaag

cgctcctctttttctctccccctctcactctgcttcacacaccccaaaca

gcccagtcccgtcaaaggacacatacattttacaacatgagtaaacataa

cggttgtttgtaatctgattatttgttattatcaacgtgttgctggccat

gtgttgttgatgtaagatgtattcagtttgatcggaatattcatattaat

tataacgagctcgcgtgagagctgtcacaacacacacacacacacacaca

cacacacacacacacacacacactgtagcaagggggagaggtgagagatg

aatccagtcaaaggggctcttaactagccgctcattctgtctttatattc

tgctgtttgtcataaagtcagctcaatgcaggtttgtatcaaaatctgac

tctgatggcaactctgcctctacagttgagtaaaactcttagcggtttat

cataaacttttcattgatcattttcccgcgattgacgacaagaacgagcg

caaaagccttgtctgattgacaagcagcacctacatgtgacatgtcaaaa

cgccaaataggataaatctgtgccgcattttctaaacgtactaaaacatc

ttatctgtatttagcagtttgcttgtatggtggctctaaactgtcaaaac

acttgtgaaaaaggctttttcggacatgacatatttgtacatgtgtacat

cactgtaacacgtttgatttaataccatttgagctggtttcagtccttag

ctctttcattttcatctcatttaaatatatttaacttgcttgttaattaa

ataccattttgtcatttaaactattatttttatgcaacaatcaacttgca

tgttaatatgctatgaagaaaaggaaatcattttttgcatgcagatttat

gtgaaaatgtgaatatgggtctataatcaccttgcaattatgaagttata

gcttttttgctttgagtatagactattcagttcataagagcaggtcactc

ttttatgaagtttgctgtataaaaatataacaatttaaaatattcataat

tatcggcctaaacatatcggctatcggcataaagtctgaagaattatcag

tatcggccaaaaaaatccatatcagtgcatccctacaaatgatcaatcag

gcaaataagataactgttctcaaacaacatttactgcaggttttatttca

catctttatggaaaaaaagaacaattgcgatttttaaagataatacacat

cccctccatgcagcttttgaagtgttaccattaggacgtagacttaattc

atagaacctgaagaaatgcatattataagtaatttatccaggttgcagtt

gttgtattaaatcggatcactgtttaatgtgaatgttgcagttgttaaga

atgatctgcagcaatatgtatagggctaatatgttaagtgttttattctt

gtggttgtcttgacgagtgttgcttttatgggattgttgtatggttgtat

gtagggatgctcaaaataatcgattaaccgttacccgaaagggtgcgttt

gtgaccgattaatgctatcagttaaacgattaaaattattattttatatg

tttttagtttgactacataaggggctgattgaatgcgcctttgcgttaag

aggggcatcttttgcacgcggctcatcccagagcagctgtttgtgttgtc

aagacaactacagagaacttttaaagagcttggtttccgctacattcatt

cttctatggcgaggaacaaaatgcatcccgccacggctacattacccatt

taaaacattcagttattgttgttgttgtttttaatagcggattataatcg

caccaaaacgtattaaaaggtaagtggattataacagcgcaagcttttct

gtaacggtatagtgctgtgcgctattgtttaatactttggtgttacgtgc

tgactgactgactgactgactgacaggtgcgcgatgcgtgaggccagcaa

acgcagaagctttcagttaagatgtacacagtttctatagttatacttta

tttagtatgactctgcatataatcactctatcttgctggagtttatagcc

gtttcgctttacttcaggacgcattattgccgctctgaaggtctaatcgc

tgtttaagttatccagagctgtataaatggacaaatcttgaatatcataa

tattattaaatattacaattttatcaacatatacagcaacacttgaaccg

cgagggagagaaaggaaaccatacatcaggacatattctttaaaataatg

atttctattaaaaatgtaaaaaggttttgtgattataataataacagcgg

ggcattaaataaatgcatattttccgtggagcgggcaatttgaggaagtc

agctatttttatttgacgaaaaaaaaaaaacatatgatttggaaaaaaac

agcctatgccggttattaaaaagaatcagtcagtattttcgttttgtaat

ataaattcattatttaagtgaaaataatttagggcagtcctatttatttt

atttattttatttagtttattctgttcttctgtgctaaacactgcaggtg

cgtgaaaatgctttgttgttgtgttctgttattaatatgctagcatagaa

aaataaatcagtattttaaaatgcaatatttaatatttgcaatatttatt

ttgtcggacacaaaatagtcacgtcaatttgtttaatataaaattaatag

taatctgaccagttaaccgttaataaccgattaatgagcggcggttgtcg

gttagcaaaattaaccgaaatgagcatccctagttgtatgtatgttatct

ttgttaaagacaaagttccttcctgtgtcaagcagaacggacaataaagt

ttaaactaaactaaggaaactaaattataacatgtattgaagttgactta

attgaacatatattttattataagattatcctagttcaatatatgtgaaa

tcaaattaggtcagcacaaatgtaacccataagtagtcagattacattac

cattaatgtgtaatatagaagatatattactgactacaaattttgtcatg

taaaatgcaatttcttacataattcttacataatcatctacttagctcta

ctcatttttatacagcagtcagcaataatcaatcactttgcctaattttt

ggtgttgttggtcattctgaacagGCTGCACGGGACTGGAGGAGCTGATG

GGTATTGATGCAGCGTTCAGTGAGTTTCAGGAGACTCTGTTCAGTCAAGG

ATCTTTGACTTTAGAGCGCAGCGTTCAGTCCAAAGAGGTCAACAAGAAAC

TGGACAAGAGCATTTCTCTCTTCCTCACTCGACTGTCACCTTACTTTCTG

CTCAAGCCTGCTCTGAAATGCATTGAATGGCTTTTACACAGgtaagcttc

agcagaattactattctttcacttacctgtggtatatgtgtgagtctcac

tttctgattcagcagtttttagattattgttttagagcttggcagacttg

tgcagaatttaaaggctccattataatcacattatggtctccattaagat

tttcattttagattttttttttttttttttgcttggaggtgaaaaagttg

ggagaaaagtgtgtgcagtgtttacctgaaaaaagtcttgccaacgatcc

cagttataagagcaacaaataataacttgacttctagttgatcatttggg

aaaagtggcagaagatttttccaatgaattatctgttgagctgcatccca

atcatcacaaatactgcagaagacctattgaaacccaaatggaaccaaga

ttcgcatagaaatcagtcaagtttggtgaaggaaaaatcatggtttgggg

ttacattcagtatgggggtgtatgagagatctgcagagtgaatggcaaca

ccaataacctgaggtaacaaatttttttgggtaaaataagcataatctag

aggccttttactttcatataagccacatctgatacaaaatgatcaactaa

aagtcaagtaatcatttgttgttcctaaaacttggataggcgacaagact

tttgtcaggtagtgtagatgaacacgtaaatgtgctgcacttttcaatca

attcaataaactagtcttgttaaactattatttaagacaaattgatcgag

atatttctgggcttttagtgattcttttaatgtgtagtttttgtagttta

ttgtgactttaaatgtgttattggtaacaatttacctgaagggtgtttgt

aagacagaacctaaattttgtcataaatctgtcataaacatgactgccac

aaagtcattgtaacagtgttgtgtgtattttttctgatattttttgtcat

taatatttactcagtaaatgtatcaatactcggtcaaaaaatgtaaaggc

aacttcatcaatatttcatgacattttagttaaaaaatcaatttgcacca

ctatagtttaggccaaaaaaatcttaataatgctcttataaagtttatgt

catagttataatgtttatgacaggtttatgacaagttatgttgtcttgat

aattggaaattgtcataaatacattttaacaataattatgttttcatcca

cctatttttatgcacatttcagagatgcacataaaaaacagttgatagaa

acgcagtgatgcgcataaatttttgaaaatgtgcataaaaaatgtatgtt

cataactgagtaggttaaactttttattcaataagaaaagatgcttataa

actacgatggaaacacttttacagaacatatttcagtatgcccattaaaa

aggtcatgtaattttgttataagagatcatgt

hi932 (3-5)

gatgatgaaaatgtgtgaatggacaaaccagctggctgagcacattgtaa

aacatctgaaatgctgttttggtcattctaaaacactgtaaccatttcag

tattagtgttattacatcaataattacctccagtcaagagcatttgtgct

ccatgtttcacacctttaaatgtcaccacatgttcattgcgtgttgaaat

tgtcttctagggtgcacatcatttattaaatattgaaaagattgacgcag

cttctccactaaaccctgtttttacagttgatatttagcaccagttaaat

aggaagtgactattttgttctctttaactaattggatggaaacaatgctt

tatttgcatgtttatatgtgatattccagttttgcgcataaatttaattt

gcatctttggatggaatcatagctaatgtcatctttgcattttaagtgac

ataacagagcaaatgacacttaatgatagttgtcataaccaaacataaaa

tctattcatattcatgacatgttatgtcaagattaaaaaggtttaatgat

agtcttatgaaaaccctctttaagttaaatcaggctgtcttaatgtatta

aaagttaataaattaattcagagagatttaagacccttaaaaagtattag

ttgcatgatgaagtttgtatgatgaagttaaagtggcgatgaggtcttaa

catgtgtggaaagagtcttaatataggtcttaaaagtcattaaatacttc

actctgcttcctgtgtacatcatgtaagtgttacttgtaacatttcatag

catggaagaaatcgtcatcgattcaatatgaactgtatttcagATTTCAC

ATTCATCTGTACAACCAGGACAGTCTGATTGCTTGTGTTTTACCGTATCA

TGAGACTAAAGTGTTTGTACGAGTGATCCAGCTGTTCAAGATTGAAGATC

CAACCCACAAATGGCACTGGCTCCATGGAATCCAGgtaaaccatatcata

tcagtccaaatgcgtgtcgtagtaaagaaagtaagagttttgtaacttta

ataaaattgtgccctgtgcttaatctgtagAAACCTGGTGTTCCCCTGGC

CCGAGGAACCCTGCTCACACACTGCTATAAGGATTTAGGCTTTATGGATT

TCGTTTGCTCTATGGTCACAAATTCAGTAAAGgtaagatctgcattggtt

gaagtcatactgccatactgtctagtattgcagtggttacatatatattt

aattctgttgtaggcgtactctgaactgacccgggatgggaactgtccac

agctgcgtgtgattttctctttctatgcatcgactattgtttcagcactt

gatgcagtggagaagatcactaactctattattgccaaactgcttccctt

tgtacaactggtaagaacatttcataacatattacagatgtggttaaagg

gatggtttaccccaaatttaaccctttcacacatgagttttttttttttt

tttgaccatta