pre-B-cell leukemia transcription factor 4 (pbx4)

cDNA: Genbank NM_131447

 

hi933 and hi1126 are both in the 2nd intron

 

GGGGCAAGTCTTTCTACGACAGCACCGCGGCTTGGGAACAAACCAACTGT

GTCGGGTCGGCTGGCATGGAGCTGAGCGTTTCCATTCTGAGCCATTTCGA

GCCGTCCGCCTAGAGCCGGGGCATTTCGCGCAAGGCCGGGGGCAGTTTTG

CTGTTGGTCCCGGGGGTTTGTGGAGCCCGAGTGAATCTGTTGCTAGCAGC

GCTCGAATGCTAGTTAGCCCCGCTGCTAAGCAGCTAGCCAACACTGCGAG

TCAATTGTGTCGGAGATCTCGGAAATACGTTTAAAAGCGGTCACGTTCAC

CCGCCGCTCTCGCGATTCGTTTTGCTCGTTGAGTTTCGTCTTTTTCCCCA

GCGGGAGGACGCTAATAAGCGGTCGCGCGAGTTTCTATTTCGATTTATTT

CCAGCTAAGACTTTTTTTCTTCTCTCTATTAGCTTGTTAGCCGCTCTGGT

TGGTTTAGTCCAGCTTGTTAGTAGTGTCTGAGATTTCTACTGTAATAGCT

GTCAGCGACATCAGCCCCTTGACGAAAAGCCAGTTTATGTGGACATGAAT

GATCGTGTTTGGTTGTTTCGAGTGGCAATAGTTTGAGATGCCGCGCATGG

GATACTTCATGTTTCCAGGGACGCTCTTATTTTCTTGTTAGTCTGCTTTA

TGGGAGTGCTAGTGTGCAGCCTTTTGCTGTAGACAACACTGGTTTTTAGC

AGGAACCGCACGCGGTGTTTCACCATCGGTCGCGCGTCGTTTGGATGTGG

TTCAGCCTCACATTTCAGTCGCACTCTCGTTGTTTGTTTTCTTTTTTTAT

CTAGTGGCTCGTTCGGCTCCGCGTTTGTATCTGCGCTGTCGGTGGTACAT

GCTCACTGAGACAGCCCGCTGAAACACGCTTTCATTGGTTTGCGGCGGGG

AAACGGAGAGATTCGGCTCAAAAGTATTATGGATGATCAGACCCGAATGC

TGGCTAGCATGGGCGGACTCGGCGGACTCTCGCAAGCCGACGTGGGTGAC

CCCGATTCGGTTCGGAAGCAGCAGTCGCTCGGTCAACCGCAGCAAGACAT

AGGAGATATCCTCCAGCAGATCATGGCCATCACCGACGAGAGCCTCGACG

AAGCCCAGGCGAGgtaagaagtgtggccgcactcaggaaaaaagcactct

ttatttgatggattgagaggtacttcattgagctctctgaggggaattga

tgtgcaacagcaaatagacacaatctgcacacctcgttgcgttatatata

aatagctgcgtttgtgcggccgcgtgaaaacccactgtgatgaaataagc

ataaggtgtaatgcgtttactccttcagatatgcacagtgcaaaatacac

tgtttatttaccacgtttgtttaggtgcttttggctccctctttttaagt

tgtaaaaagttggccttaagctgattgaggttaccatattaatttgaggt

tttaatgaagaaaagcatctgcctaatgaatctaaatgcacttggtaaat

gatcttttgaggattacataatgcaatcatgttttaaccctcaggtgctc

ctttcgtggccgccaaaaatgctcgatttttaccatttgttttgttcagt

atttctttttgcattgtatgctatgcatttctattggtttagttattatc

tatttattactcattaatagcctttatgcatagacctgaatatgtagttt

tcaacttaggtttttggagtacagactaaagtcagtaagatttagtttta

gcttttcttccattacaattttaagttaaaaatatgagtaaaagcatttt

ttcaggatagccaacgtttacatttcaagaaagtgtatttaatcagtttt

tgtgagtccggtagtttttgatttaaaaaaaataaataaaccatttacag

gaattttgtgtctacaaatcttgagaaaagcaatcaaactcagtaatttt

aggttgatacgtttataaaggtgctcaggtgctcctttcgtggcagccaa

aaatgccagatttaaccaatggttttcttcaatgttttgtttaaaaggat

tttatgttacttatttcagtttatgtaggtattatctacttatttacagc

atttatgcatagacctggaaatgttatgttttttgagtacagacttaagt

cattcagatttagttgtagctttcacaccattccagtgttaattaagtta

aattaaatgaatagaagcatttttgtgctaggattacccacaattacatt

tcaagagtgttttttaaccagattttgtgagtccaatggttttttgatat

caaaatagaaagcatttaagaattgtgtgttttcacagcaaaacacatga

atcgaagcacacgttttaagaaaatcagtaattttaggttgcaaatttat

atatatgcctttgccaagtcctggagggactgtttaaaatactattacgg

ccttgtgtgtgtgtgttttgattttaacgatttctgccaacaaacatccc

tgaattcccctcctataattcccttaatatactccaaaaataaaccaaag

acacaagtattttccctcctttggctttgctaaatggggccagaaaggct

tcagaggtcaaccaatatgtttgttatcaggagcccatgggctctgtgaa

gccatttggtcttcagcgagcgtctgccagattgaggccccactagataa

atgaattggattaatgtgctacctcgtcattagcatagataatcagcacg

cgcttaattaagtcatcgccgtcaaacagtgtcagacttaacctcgagac

gaaaacacccgacaagtttgacgactttcccaccttttcctgcagattct

cctcacacacagccggtgtgtgtttatatatttatatatattgaccgcag

tgaaattgatctggcatggatcgctagattgcgcactgtgacctgcgatc

tgttgaaaggtcagtggagtggcggatcctggacaaaagctgctttttaa

tgagggatcgtatgtgcgtgtatgccctgtgatgtgtcattagcttgtga

ttttccaccaagccatttgaccacctggttctcttaattaattcacttct

cttttaccctcctcctcctccctggtgttcatccttttcattgtgtgttg

ggcgcaatcaattctcctataatgtgtgcgcgtgtgcagctgtccacaaa

ttgagtttctattaatgagatggagggtcgcaacacggccaacttatgaa

cgccgagatattgcctttatatctatagtgcgtgcgttgggtgattgtgt

cgtgtagtgactttgctgcgcttgtgcaagagactcatgaatgaatgatg

ttgcgagagcgtgcttgtctggttgaagtgggttttatgggtatttggtg

gaagatcagcagtcattaggaatgaggaactgttcaccgaaaaatgaata

tacttttattgtttcgtcgaatgccctggctgctgggtgtaagtaatgaa

agcgattggcggtgccatccagctccataaatgataaagtactaggtagt

taaaatgaccggtgctatatatttttaagttttatgtcagatgccttatg

aagccgtatgataactttaaggaaaagaccaatatctaaggtggtcgagc

gtgttttataattgaagacattcccgactgtcaattttaaatacaaaaaa

ttataaattgagttaattatacccttaaaataattttttatgtagcgtaa

aatgattgtacgtttaccatccttagaacgatgcatttggtgtgttctct

aaatatcagttaagcgttaatttcgtaataccaagctaacaagtcttgtt

tttagggaaaatcgttcacttaataataattctgcacaatattggaaaaa

tctgttatcgcgatattttgtttttctgctattaatattgtgatgtaaat

atagattcacaagactgttgaatggcactatttctctaacagtagactaa

tagggagtctagcatagacatggtacgataaccgtttttaaggaatactg

cagttcggaaaagtcaaggttttaaaaccgacaattttctgctttactgt

ttctaaggtataagtaagattttttttatttactgtttttttaggacaac

agcaatatcaccagcagaaaatctctccaaagatgccgttttaagttgta

aaaacatctgtgtttttgaaattaatgacgacatcagccagaagtcaata

gtttattttaattattaagtctgacatgtttgcagttaaattgttttttt

ttttttttaaatgtttcccaaattaaaatgtattgtgtacaaaaggggaa

aaagtttttgttttttacccagacatttataaagaataatttttagagca

gtgatctcaataccgtaataccggacatcgtgatatttatatccaaggtt

atcataccatcagaatcttatactggcccatgcctagtctaacagtattc

atgtacagaaattatataatcacaatgcaaaaaaatgctttcttactttg

ctttgtcttatttctagtctaaatatcaaaaaataaatatcgaaaacttc

gatcaagttaaaatattgtttggttttaaaattcagatgaaataaggcaa

aattaagagtagaacaataagtgaaataatcttgtttgagctttgtaatg

ttaatatttggactgaaacatgacaactgtgaactggtcaactgacaact

ggtcaactgtgatccagacttaacattgcatatctttgcaatatggctat

tgcagatgggcacattgtgatgctaaaacaatatattgtgcagccctact

taatgaatatgttaattttcaacttaaaacagtgttttggccactcattt

acatgacagcagcagtttgaggatgggtctcttatggttttaaagttttt

ctgaaacgtaccgtttaagtgtgtactatagcacttctgtattccagatt

cacagcacttgacaagcaaacaacaatgcgtagctgttacactaccatgt

tttgtgtgttgtctttatttacatgacaaccgtgttttaggtactgaaaa

tgcatacgattaaaagttttgacatcatgttcatgttttttttttttttg

aatgtggtgatatcttgtgcatgagtggtacacgttgagtaagtggacgt

gcactaagtgttggttttaatgccaagcacaattaaacaaacaacaatgg

cggagtacattgtagtgttgttgctgctcatgagttgggccagacagaat

ctgcggacattttttgcttattccgcagtgaattttgtaaaagaaaatct

gcagatttatgtggaattattttgagagtatcgtaacaacaaacttaata

tatgaagaaaaaaatcaaacatcttaacttttattttgtttacaatgcaa

atccatctaaatccgcctatttggtaaacaaagcatgtttctcgtataat

atgtttactgaaagacaaaaaatataactttacaaactgtattgtaaata

catgaaataaacactgtcatattagtcagtattatcactgaagttaaaaa

ctgaataaatacaaatttacacaagaaaataaatagactcattgataggc

taaaaatctgtggattactgcgcatgtggatttcatgtgcaggctcatga

gtttgtaatgtgtcttcagtaaagtgtggatttgctgattcaataataca

accaacagttgagatgcatcataaacacacatttcattttaaatacagtg

gatgctaagctgccacaggcacatcgtcactttcaagtgacatcgtcaaa

tactgggccgaaatgtataatacagaattttcaatattttactggcggtt

ttaaaaaaacgttgttgttaaactttgaaacataagggacaaaacaaaac

agttttttttaatctaaaaatagcctaagactgtatgtgcgtaaatgcaa

attgtttcttcacaatgtgacagtgccatctactggcctggtggtgcata

atacagcatttgtaaaacatttttaagatgcaaaggatttttttattgtg

cattgctgtgtaaacttgcctttaaaatgtggaataactttactttaaag

gttacataatgcagacttgaggaaatccagaaagtgctgtcacagtttga

catcgacaaaacagtataacaaaactccttcattcgaacaaatttgaagg

caaaaaatttgaagtcaatgtaatttttgatgtgagaataataccaaaca

ataaagcaaaaatttttttttaatcagtcgagtaaatcactattacaata

aactaaaccttttattaccttttacagtgcaaaataatccctcattgtag

ctctcaaatcttatttaaaaacctgccatcttcaaacatgcatgaagatt

tgtcacagcatgtgtcatgttaatgattccaaacactgtcggttcttgtg

tctcatcatgatacagatcatgatatggcaagtttgaatctacagatgtg

aagtacaattgagagctggagaaaaggggaaagacgtatgataaagggtg

aacagagcatctcattaacgcgatgctaaacaactgaatgaattttcatt

tttgggtgaactcttcctttaaggatattaccagaaatagttggtgatgg

gcgtaaatggattttctctttagctattgtttctctgtcaccgatatctt

acagattttcttgagtataagcacttgccgccttcagttatgaggcaaaa

aaagcccttcggtgcttctgcacagacctgaaatagttcagatacctgag

agaaatatgcattattattttgtcaagtgtgggatggttttagggcagat

gaggcagcttcatttgcagagaagagagcttgactccacttcagagggat

tctacctagtgtggtcagcattcctggactcacaatgcattttttctctg

tcccttttaaacagattcccttaatttgatactaatgaaatatgcacagt

tgtggtatctcattaaatggatttgtggctcatcataatgcctcttaaat

taattagtataatgtgtcccaaacctgcattatttgctgagtggaggcat

gtgcttcgctcaagagcgcaataagacctggtactggcggttaaaaacaa

acaaatgaaacgcacaagacttcttaacttgctttggtctgttgttgtcc

cttgcagtagttggcatataaggtcattcaaagtatactgatttcatcca

ttcaaaaatgcttccagttaaaagcaatgtgtgcttatgtgcttgatcat

ttattcatcattttcttttcacactgactctttagcttgccttttattta

aaaaaataaataaattcaactgatttcattctcatatgccacggtacttg

attttctgttttgttctcttgatctgcattatttactgtgggggtctcta

gtccccagtgttgaggggtggatgtggtgggatgtcattgggacggtggg

ggcagatgccagcactgccctcagcctctcaccctgttgccctgtgtcca

gatgctggccagaggaggcaccggcgcagtggaccccacagagggagggg

gagctgggggggagcacagcagggtgtgccctgccgctcaacttccagca

caggtcagtacaggagcgcatgagcaccccccccctcctcttctctcccc

catcatcccctccatgctgatgacaaagagaaaaatacagttcagtcttt

taaagacctgagcggggctaaactaatattaccatcttcgaatgtgcaat

tcttcttaaaagaaccaaactcagaccactttgaatgaagcaaaatgcaa

agcaagttgagaaagaaccgccgtttgcattcacattcatagaattgggc

tttaatttgggtcagttgtagcaaagtcttgtggtcaaataccgctttta

gttgttcatttttaatggagatttatttcagtagtttttaactgtttttg

gttatcaaaaacattgttcgtagtataaattcctcatttaattactataa

actaattttttaaataagagcagctctgttgtaacttaaaccttaatttt

caatattagtgtgcattttacagtagttttgaaacatgcccccaattatc

tttaaagataataaacataagcaacttgaattttcctttgtttgattgca

tgccatcattctctttgtttagtagcctatattggccagttattatttgt

ggtatgtgtttagttgtgtttgagaaggtaaagtgaacatggagtgtttt

tctgtttataagtgatgcacttaaagtaatcacttcttcagatagtcttg

attagttacatgactcccagactctcgaccaaccaccacatgaatatttt

agtcttacaattaactgaaactctttgcccttttcataaacaccctagta

aaagtttacattacgtcttttcatgatcatccatctatagactcaagttt

agttttctctttgtgatgtctgttgtcagtttttgatgtttttttttttg

taattgtgcttgtcgcaataattttcaagcataaagaaatgacctacatg

aacgccatctcattacttgaaatgtttgttcctcttgcattgaatgctac

atacctgaaatatctgggtgtgaacgcgtcaaagccaacaaaggacattt

taagcatcaaatgaagtcttagctaggattttgctctaactcacgttgga

tgatactcgagccagttggaaagtaggcaatatgacaaaacaagctaagt

aatcaacagtaaccagttcagcattgcccaagctagtgctgttgcccatt

tccaacaaaattacccaacgcattgcactgtgtgtcatcagcttaaggcc

tcatccacaaaaaacaatctgttttttttgggatttcccatgttatatgt

ttgcctcgagcgaaagaggagcaatctaacagtgttaagttgcggccaac

tgcaatattaggcagttaagtgttgtggtgttcagtttagtccttttttt

aaaagattattcaggcttttgcagcagcctgtagcaatagtaaacacctt

tcgcgtatttggaagtgacggtgtgtttttgaattgtggcattatcgctt

tgcatgctcaggtggcatgttaatcccagctgttagctgaaccgctttaa

cgagtacacctcgattattggcatttgttacgggttaacaatgctcctgg

aaagcatgcttcatctgctctctaatacagtagctctaaaatctggctgt

gtgtagataagcttcctatgcatcagagcttacagagcctggaaataaag

tttgctgatgggagactgccctgaaatgatcgatgattgggtttagcaca

tatgattctggctttgagaagaatgtttccacagcaagacggagggtcct

cgcttgttttgatattctccagacctgctcaataaattaagcacgttcgg

ggtgtaaaaagggctggataataccattaaaaggtggaatgcttttccct

gaagacaaatgatgaccatgtgtcagttactcatttagctggagtgagct

gagaccgctgctgtgtcttctcaatctacagacactgagctttttttaaa

gactcttagtcttagtgtgtccattacatcttgattgattcctgaggaga

tgtttgcacctgtgattgtaatcatatccagcggtgaatgttaaaggttg

ttggtgtgtcttcggtaaccttaaatcccctgcttggtttaaagacgatt

gatgaattgtagagcggtggtgaaaaaaacgtttataaaaacaattctat

ttatttacatataattcaaaatgcatcatttatttagaatcgattctgag

ctggggcattatggtggcgcagtgggtaacacgatcgcctcacagcaaga

aggtcgctggtttcttgccttggctgggtcagttggcctttctgtgtgga

gtttgcatgttctccccgtgtgtttcctccgggtgccctggtttccccca

cagtccaaagaagtggtacaggtgtattgaataagctgaattggccatag

tgtatgggtgtttcccaatgtttggttgtggcctgaagggtatctgctgc

gtaaaacctgctggataagttggaagctcattctgctgtggcgacccctg

attaataaagggaataagttgaaaagtaaatgaaataatgattctgagct

tagattttataactaggctaaggctagtttttttaccatatattcacaat

attaattcgaaccctgctcaagatgatgaacactcttgtaatttgtttaa

atctttcttagctttttagaagttaccatttgtaaccctaacctaaggtt

taagtggtgattgtaaggaattagatgcaaggagagtacagctgtttgta

aagcatagggtggcatctgcttttagctctaatgtgtactttaagtgcag

ctgtatgaacatgatgtgcttaaaatattttggaaagattttgctaaaca

aacttgtctcaagaatctgccagaagtgaccatcctattttcatagttgg

caatgtcagtgtttgtcttttactgtgttgttgatttggttaagtactag

cgcatgaatataagctaaatagtagtaaataaataagtttgtccttattc

aggccaccaaatcacttgtgtaaatgaatggccaaaatgcacaacctgtt

taggtgtaactatgtcaggtaaactttcaaagcaatcattagcagctttt

tttaaaaaggagacattcaatttactagttagaaaactgagcattcgtat

ttggagaactgagtgctacatgattttagcttcatgcaatgtgtattcgg

aaatactcgtttcaaataaaatccaaatgtacattttttttttttttaaa

tcaaacatttgtgtacgttttttttctgattgtggcagaaaatcaccagt

agtgattgaaaatatttaattactaatattagcagtctacacatccaaac

gtgtaacgtagatatctactagtctagtccccttcatccttcagagccaa

cccacaagatgagaaactttgcaaattgcattgggcacgtcttttgttgg

agcattacttgtgccatggcctcatttgaatcaatgcttcagtcaatccg

gcactgaaataacacacacatgcaaaatccgtggataaatggccctgaat

atccttccgcgtgcttatttctcattgacaaggcctttggtagatttcaa

aactgacaggagggcactttgttaattgggcgcagtgttcgacagatgcc

aataagcttaaattgggcaaatagcggtcgatgtgttggtctttgagcat

ttgcgttgcattacaagagtctttctaacacataccctctctctctgtct

cttgcagAAAACACGCACTGAACTGCCACAGGTTGAAGCCAGCTCTCTTC

AGTGTTTTATGCGAGATCAAAGAAAAAACTGgtaagtcgttcacttactc

caccaatgcagaatttcttctctgcaggtttgtgtcttcaagccgcactc

ccacattttgactagatctctttcattactctgtattgattctgcattga

ccatatgcagagacgggtgtttaataatcatcaggctgaatttattgcat

cgctgtagtcctttatttatttttttaagcgttcccgaggcatttccagg

tgtcttattgtatcgcccaccgcaatcgttaagtgtcatagcaatggatc

ggatgtttacactgcgtgaaatctcacttgaatgcatttcagagctttga

actagcaacaggtgcgtcagcttcagtctcatcgttggtttataccacgc

tcttctcattgcaaacccaatgcacgccaacatggtccaaacaggtaacg

gctcccgcatcttaactgcaagattcactgtggtcagtttttctggcaga

tccgcagctttctcccctcaaacgagcggctgacaaatgattaaatattt

atggaggtgttggcgttgtctttgtgccatggtttctctcgtttctttcc

tgtcatatcctgcagcttgaatccatctcaggttctgtaacaagcatgct

catgtggaattacagtgcaaaaatgatgtgcagcggtctgtttgtggcaa

tctgtcaataacccagtcttactttcctataattggatgcaagtaaaggg

taggctagaggaatgggtatcgggggttgtccctgttgccaaggcaacct

gctgtcttatttacctaatgtcattcactttgattttcacatttagcctg

ccagtggagaaagggccggggagaaatgcagcactaaatggaaggtgttg

tcgacagtgcagacaggcgaagttaatggtcagaatttttccatacatca

cttcgcttatcgccaaacttaatctacaatccctgtttttcccctcaagt

ctttgacgtaaatgagctgatttactagatgacacgagtgaggccattac

tgtctgatttgagcctcagcttttgctgttaaggcctgtttacaccaaat

tcattgcgtctgaggtattaaaaacacaaaatatctaaaatataaatata

cccaatatatttctaaatgtatttctttttgtcaatgtaaaattcattgt

actaatgtaattttctttaaatatcaagcatttcaattgacattggtgaa

aatgtcaaaaatatgtaatattttaccatcatattctgacctttgcgtag

taaaatatatgcaggttgtattaaattagattatattttaaatatacagc

gcaggaattttaataaacggcaaaaatttaaagactaaactcactgtggt

ggttaaataaagttaaacttatgtttttatgttatcgcatttacatgtca

tatttgggcacttaagtgatgtatgagattaagattaattaagaataaga

tataagattaagtaagaatagggtgtgtttttattggagctaaattcaat

taaatatgagaatgcaaactgctgtttgaccaaaccaaaaatgtttcagt

ccatttgaaaaattaaggatatttgaatgttgtggtaatttgtttttctg

caacaaatattagatgactgactgacttgaatagctctacgtagaaataa

atccttttagatagatttgagtatttttaaggggagcacatcgataaaat

aaaacaataacaaaaatagatattaaaatacaaccgtacaaatacacaag

tagaaatgcacaatatattgtttcagcatcgatatcgcaatgtgtgtatc

cgcaatagttacattgcaatatatgcgatgttgagtttgtattatagtta

actaggagctacagaattttatttaattgctgtatttaatcaattaaatt

aaattcaaataatttttattaatcaaaaaaagtttatttttaacattttg

tcttgtttctagtgcagatatttacatttcaaagcaaaaacaagattatt

ttacttaccccactggctgatcatcttaattgtttcaaggaaaaactctt

aattttgccttttaaatgtcatctaaatagggaaaagtaattaaaaacgg

cattcagaatctataatcaatctaattttccaggtaaagttttttcaata

ctttttctataatttatacctatgctattatgatttatacttttctgatg

ttatacttatgctacgcgcatgcgtacagtccagcgcagcctttacatgc

ctgcgcacctctcaaaaaatgtaactacacgtcacaacagcatgtaacaa

gctttttgattggttggtttggtggtggtgacaagggtgggcggcgcaga

gactacttacttaactttcaattgttcagagttgatgttaaataaataat

tatagatagtaggtcgtgtgtgtttacttcaattattttaaaatcaagca

atgcaccctacattcaaaagtccctcacttttaatatgttaacatttacc

gtacaaaacttgaactatgtagacaaaaatgtaaaataaataggtaacat

aattgttcatgaattctaatcaagttaaaatgttcaattaatcaaggttt

tgatttcaggccaaattagccagcccttcttctgaagttgaaaacaaaac

aatatgtttacaatctttacgatctacaaatatttagatatttggattgg

aacaagacaaagcaaagtaggaaaagcattttttgcattgtgattattcc

atttctgtacgtaaaactgttagactcctcagaaaaccagcaaatagtgg

cattgaaactatcttgtaaatctgtattttgcaatatttaaattgcaaaa

taaaaaaatattgcaacatcagattttcccaatatcgtgcaaccctaata

caaagacacaaattaaataaaaaatgctttgtaatttaccacattgttta

atgaaatttaaaataacacttcagtgtataaatttacttgccctcagcta

tattttactttttaaaaagtgtgtattacttaaaatatattttgaaaatc

tgttaaaaacaaaatatatatctatttttttataattattttttaggatg

tttttaccttttatgataggacagtagagatttcagacaggaaagcattg

ggagtagagaggggggtaggatcagcaaaggacctcaaaccaggattcga

actcgggtcgccgtgagcgcgtcactgctatatgtcagcgcacagtacca

ctaggctatttgcgccaacatatatttttaaaggaaagctggaaacctgt

agtcattgactgtaatagtaggaaaacaaaatacaatttaaatagatgat

tacatgttttccagctttcttcaaaatatatgtgttgtatttatgttcaa

cagaatcattgaactcttaaagatttgaatcaacttgaggatgagtcatt

tttggctaaactaaccctcttattcttacctaaagctacacatgttatta

tttctagtgctcaaatgctttgaattgtcttgaaatgctcacacagtcac

ccatcattcaatctgctatggttaaactcagcagcgactccacaaatctc

atgtgttctgaactgtggctcctggtccactataatcccaactcaacatg

gccgatccacacattgcaaatgtttcaaatgcacacattgcaatgtatca

acgccgaaaggatatatatgcagccctagaaatttgtattcaggattggt

ggtgtggtcttaatttatttttttgtagtattatggtcggtcttgggtga

ctcaatcacatattcttttaaactcttatctatagtgttgagttttcaat

gacacctaaatatttcaaaactcaatctagcatttgaataaaagtggcat

cctgtcaaagtacattgtttcattcctcatacaagggatttcatagaaag

gtgttgttttgcttgaatatcaagtctggctttgtctgaacaggcctcag

ccctgagtggcggatggtgtccatcatggtgatgtgcgtgtgtgtgtata

tacacagtcaagcctgaaatttttcatacctctggcaaattctgccgaag

tattagttcagatacaaaaccagatttttttttccccacaatgatggctc

ttgtacgtagtctcatttcctataaaaaaaaaacttgctggtggaataaa

attatttattaaacattaaattaaaatctgaattttctaaataatttcag

gcttgactttattaaggatgtcacaaagctcaatataattttgaattgtt

tgatgcgacctccacggttcaattaacgtacgaaaattgcattttattta

gttttgcatttaagttaaattattttagctttttccccatttcctttaat

tattctctgaactggctttgtgcttgttagaacgtatgcccatatgcaat

gtgagcgatttctgtttaaactaaattcataagcttttattatttaaaca

ttgaacctcaaagtgtaaagagaacttgggatctgagaagtgccctcatc

tgaacaggtttgaaagtggcgactaggtatgggacgagaacaggtttcga

ggtttgccatggtttaagtctaggttttaatacagctaaaatggtaaacc

attcccaaggtatatgtaagtgttgtttttttgtgttgtaaagaaatgaa

gacagctgaactatttagcctgacatgtttacggctacaaaatactataa

atatttcttaaaataaaatacattgtgtgaaatagggaaatatattgtgt

ttttttacccagacatttagtaagcgctaataaagcagtgatcacaatac

catggtatttttgtctaagttcatcataccgtcagaatcttatacatagt

gaaatgcaaaaaaagtcttgtttctcaatggtaaaacttaattatgacca

atatgacctaatgagtattcaatcagttagattgggctttagaacgtaaa

cattaaagaaattgttgcctgtaacattgcagtgtgctggaactgtggat

tcatctatagccaactgtttttaatattaatcaaacaacaaaagataatg

aaataactccctgttgactgagtaactattatgcaataattgttaatctt

tatttaatttatacagtgaagtttatatacagtatgcagtgttatatttg

aatattattcagtttctgtgcctaaaaatcactgttagatatgtgaaaaa

ccgttattattttagtagtatcttcattatgttgtgtttatttgtgctta

tgcttattgggattgtttttatgtttttgttcgacaatagctaagatgtt

tccatctaaaatgtgaattaactttatgcgtaaaactggattattgcata

aaagacatgcaaataaagcagcgtttctatccaatgagtcaaagagaaca

aaatcgtcacctcctgattaacatgcgccaaaaatctacagtaaaaacgg

aatttgctgtggtagaagaagctgacataaatgtgaggtggcgtttgaag

gtgtgagacactgagcacagacgctctttattctgtaggtgattaataat

ataataacactaatactgaaattaaggcattttagaatgaccaaagcaac

attttagatgttttacaatgtgctcagccttctggtttgtccattcacac

aaagttttatcatcacatgatctcttataacaaaatcatatgactttttt

ttttttttttatgcacatcctggattttgttcagtgaatgtgtttgcatc

atggtttagttgcatgtttcattactgaataaaggttcagttatgctcag

ttatgtgcatatgtttttaatgcgcagtttcaaaattatctgcataaaaa

cagatggatggaaagctagtgtctagtgtccgatgattcgaaccgtacca

tgataaatctttattgttgcatttttgataactcgccctaaactatggca

ttggtattagttaatagctaaatgtaaatgtatgtttatgcagtcataaa

gtaaatagcatatgtaaacctttttaatgtcattgtttagattttagatt

tgtttcatttgaattgtgttgcacactgacgcgaatactcttgaattcac

aaattttcattgcgtatcaaatcacaatatcagtgagaaaaacactatcc

ttgtttaaacgcacaacccttttttgaccttttataacgcagttttattc

aagattgggaaacataaacatcctaacaaacaacgcaaacatagatctgt

ttgaagtagttttccaactgcaagtaataatacttttaattgactaaaaa

tttacataaagtaatccaattgctgggatccatatatatacacatacata

catgcatacatacatgcatacatacatacatacatacatacatacataca

tacatacatacatgcatacatacatgcatacatacatacatacatacata

caaacatacatacatacatacatacatacatacatacatacatgcataca

tgcatacatgcatacatgcatacatacatacatacatacatacatacata

catacatacatacatacatacatacaaacattcatacaaacatggataga

tgc

hi1126 (3-5)

atgcatacatatacacctgcctctctctaagactccctgcagcttttatc

tcctgcctctggaatgtgaattaaagaaggcagcctcctctactgcacat

gattgtagtgctgatcagtagtctttacatctgttttccacagtctcagt

gtgtctgcctgtgtctcgctctctctctcctgcatggaacagcagggata

aaagcgagctggagctcaggcctttccctgccgctgcggtcttgtcctct

cctcctcctcctccctcctgatgccttgcttccattcttgaaagagaagt

cttgctctgaactcggggctttgatatggtaatggaggtggaggggaggg

ttagggaagagtgggggaggggcattgaattcctccgagtgctgctgcag

ttgggaagattgttttttattgttaaggaaatgttctgctcaaatgcaag

tcactataacacccccctccctgcatcatccccatctgtttaacatgaac

ttcatgtgcgtgaaatgtaagatttgttcattaatctccttagaaacaaa

ttaagagagaaatgaggtttccgaggcgattgtctcttcggtcttgaccc

cctcccccatcgacttaaaatggttgcagcaagttgattctcaccctctt

cagcaaccctgactttttgttctggctgcccagctcatcgcagaggtcac

atgccttttgtgctggctgtttttacaggtttttgaattgtaaatgaagc

tcggccaatattactactattattttgggcagttggttaaaaaacatgaa

catgatctccctcctttattgtcatctggatattagattgaaatagatgc

acagtaaaagtttatctccagagactacggtagatgtccttgagtggaac

aagtactgcttggatcaagttaaagggatagttcactttaaaattttgaa

gtttgtcctttacttgcccttttcttgtttcaaacctaaagtttaccaaa

cctgggttttcagaaaagatattttgaagaaagctaaaaatctgtaacca

ctgacttccgtagtatttgtttttcctactatggaagtcggtgcctttca

acttttttcgaagtatattcttttgtgttcaacagaaaaaggaagcttgt

atgtttgtaaccacttgtgagtaaatggtgagtaaatggtaattttggtg

ttaactatctcttttaatgtagataatatcaacatgttctcaaacctcag

gagaatattaaagcattttaaagttctggctaatgttcgaccttaggttt

tcactcaagtgaattttttttagacttttattaaatcagaatagtatttt

tttaagcgcatacttacactaggtacagttgccttgaactgcgctaaagt

gcgattggcccccctcctctcttccccggcggtctgcactcacactgcat

tttgccttccgagcctgagcacgcttgcgtcgtctgatgcaattgttcag

tttaacaggtagagaagcgttcttgctcagcatagtggagattgctttag

atgtattgttttagctgtttgggatgcagtgacaagggctgtgcaattaa

tcgaaaattcgatttaaattttggcttctaacaattatgcattaatcaag

attaaactagtattgcatcatataccatcccctttccagttgtacacatt

tgtacacatttctctgcaaatctcagtttctcttgaaaattgtgttttgt

ttttttttttgttttttttttttgcatcgtttattgatgtacattcgaat

cattcatgtttttaaaatgtgagagagatcgcatgctgttgtgtgtgtgc

gctcggcctcagagacgaacagagcacacaaatctaaagtcatcttaatg

agagtgctttaatggtcaaataagtgtcaaaatgcggtgtttcactcaca

atgaatttcattatccctcacaataaattattaacaaggtttggtttttt

taaaaaaaagaaataaaattaggttcatagatcgaaactgcccaccggat

aattgaaattaaattggtgtttttcttatgtccgcctcaatgatttgcat

gaacttagagtgaactttaaacaggtgtcaaccagttagatcactacacg

caaatacccttgagcagatggtatccagtcgcgttaatggaacactgaaa

aagtaatgtgattggttgttgttctctgcgtagcgtagacgctggcatat

tttgtgaatgaaccgtgaagcttgctgaaacagtgaagtgtgcagccacg

ttggtgtggaaacttcaaagtatgtgttattatcattctagatggatatg

gtgaagatgaggaaatatctgataactaagattagaaattaactgcgaaa

aagcctcgacttgggacaagattttgtgtaggtttttggcccgtactatc

atagtggtaaaatatgcgcttgagccagacactgactgagtaggtttact

tttgcacacaaaatatttgtttttgttaacttagtaaatggtgtagttat

cgacgtgttgactaaattagccggtgctctattagcccatgctaatgatt

tggtgttacttgaatgaacacgatgcatttgttttgcacaaaaattagtc

attggtgtgttacacatggctcaaatatgtaacattaaaggacacaacat

ggcaaaataaagtcaaacataatatttattctaacacaaatgaaaacaac

aattaaaacatcagtttctgtaagttcaaacagtgtaaaaggcaagtgaa

tgaatgcggtaagtgttgtcagtgttaagcctgatttatacttctgcgtc

aggtgaccggcgtaacccacggcgcatgcatcgtgcgtggctgtgcattt

atacttctgcgcgctgtctctgtcggtctgcattaacacttccgaaacgc

tagttggcagtgaggtgtaaatgttcctctgtgtcgagtttcttctctgc

ttttttgcttttcctgaacacttccgggatgtacaagtggctcaaactcg

ctcattttggggcaggaaccggcggacgtgcaacaactttaactatgagg

taaacacaaaacaaaactttccatccggagctccttcacgggactccaca

cttgtaaacaatcgctcgcgccattcacgcggctctcggtcccgcccaga

ctcgtcagcgctacgaagccgaccaatcacagagcttacgctacacgtct

tgcatcgtgtagttactttttttgagaggtgcacgtcagcgacggccaca

gcgaagggctatgcgtcagcgccgtagcatacgcctgcgtttgacgcaga

agtataaatcagcctttagtgtgtggatgcaaaacaaaacgtaacactta

cattgaaacacagctctggccaactgcccaaacaatgaaggaacagtggc

ctagatgaactctcgcaccttttaaataagagcattgactatataattag

gtgcactgaagtcacatcccgacctacaacagacaataagatacaaaaac

acaacccaaaacaacatagtcctaacggttgtcattagacagtgttatgt

gctgtcagacatcatgtgtatgtattttttctgcataaactgcaaattgt

ggcacgttgtgtaacatttgcatcttgtgctttattaatgacacaacgga

ctagtcaaggttgcatgaaagttgacttaatgtaaagtcattcaactctt

tcaattatacagtatagtacaaaaattgtttcatgtactaaattattaaa

agtcaatttaaatgttttaacattttttaaacagctaggacaaatccatt

tgcagcaagaagtttttaattatttaaaataggagttaaattatcagtta

atgcattaaaatatttgattatgtgggaatattttaattttgacaaacat

aacagtttacaatagtgctgggcgatatggcaaaattgctattttgatta

attattttccatattgaacaataatgaaatctatttctaataacatttgt

taattcttctagatttaaacgagtacctcaacaatgaccgaagccacaaa

aatgagtttgtccattaaatagcataacttgttttcggttgccaatattt

tttggtggccagaaatttgttgcatctccaaaatcaacacacttctagat

ttagattgttgtacatttctgcagtgccattggctcttagatcaatatag

agtaaaaaaagcccagaacttatcattatcacctagtttctaatatgaag

agacatttagttcatttacattgtgtttagcagacattctttatcaaagc

aactttggaaacattaaaatttctatttgacacacacttttatccaatcc

aactttcaaatcagtccaataaaagcaatcataggtcacatccagacagc

atgtgatttaagtcaatctaaaaagaaattatatagttttggctttttat

ccacatcatgacaaccagtgttgtgataaataagttctggaccatggtgg

aaagagtactgaaaaatcaaacttaggtaagagtactattacttgcccca

aaatatattgcaagtagagttaaagtatctgttgtaaatattactcaaat

tacgcgtaaaaagacctttcaaaagtatttgagttgtcagtagtgagtat

tactctgtaaaaagcttatgcatttacatgtaatttgtgcatgtgtgttt

aaacgtaacattctgtagtgcatcgagttattgcctagcaggcacacaac

gtcataagactttaatattagtttagatttaggttatgtcatgtgaccag

aattcaatgtctaactagcatctaaggacaaggttattgtgatgtccaat

catgacatcaaatcattgtgtgtaaagattatggacatcttctcatcttt

ttggacactttcttggacacaagactaatttttgtaatccccatagacta

gaaatataaataagtgactgcagattgaaggaaagcactaaaaatttact

caaaagaaagtaaaagcacatgaagtgtaatttactattacagtagtttg

agtttttgtaattagttaccttagaccactggttatggattgtaaaaatt

tctaaattcagcccagtgcgtagccatatgaatgggcagaatgctgtcct

ttaaaatcgatgatgtcacacaagcatgtgatcagaaagcaagcctgcat

gtaacaaacataaaaaacaacagcatatttatcagagatgtgtgtttgta

ctgcaggtgtgtgctgctaagtgcattagcagcattacaacaaaacctgc

taattttgtatcaactggacgaccaaaggaaacgcattaacaattacaca

tgacagatatttttagatttacatgcgttcgccatcatcttgtgtttgcc

tgtaatcagcgcattgaagaaggacttcatccacatgctcactgcctttt

ttgattttagtgcgtcctgcatctgtgtttgtttacactgccacatataa

gtgtggcatgcatattacggcatctaaatccagtttttttttttccatgg

ggaagcaggcatttcttgaacatttcaaatatgcagaacaaaaaataaac

tggatcattgctgtgtggatgtagttttaagctcagaacttaaaaggaac

acctatcataacaaatgaggtggaagaaaacacactacatgatgactgaa

aaatgtactttaaattaaatcagtgtcacacaagacactgatttaatttt

gtgactacatgtacatctgtgatggacatggaacaaaaatattcagtttt

aaaagcatagacgtcttgaattcatgtttcaggaggtttggtggttaaat

ctgatggctttactgtagctgatcactcctttgctaatattgaagtcatg

tgatgtttgtagagtacctaccagaagaaccggccaggttaactttactc

atggtgcatttctgctcttaaaatcccagaaacgactacatgatttggca

gggctaagaattctgtggcctcaaataaacccagtgctgcatgaattaaa

tatgaatctcattgttaatgtctgagcttgttttttaaaattgtttaatg

gtttataaaacccacttgaaggggctttaaaagcacaaaatgtcctgatg

gtgtactgaagaagtgatttcttgtcttggagtgcattgtcagtaatttt

tattttttcagtttccatgaaattgtccattttggctactgcttagatgt

gctaacttttaatgttcggtatgtggcattgctaagaaatatcaggtgaa

gttttattatctgcatccttgcggtttaagcagcaaatgatttagagtgc

tcaaacgatttggcactaacaaatgcttttctaagcactggaaaactttc

ccatcaagccatcacctgcagatcattgtaaaacttgttgatggtttcca

tgcagatgaatgttgttccccagcaagcttatttggttctgaaaaatggg

ctcaagtccatgtttataaccaacctgtatgaactcaacaactgtggttt

cacagactgcgcggtcacggacctaattaaggctttttaattatcattca

tttttgaaagaccttaatttgaaccttcttgtaaaattttatgagttgtt

ggaaatctcagactcattttacgaggctgagcctgcaggcctgtaaggaa

aaggagccagcggagtgtgtttttactacttaaactgtaatagatactca

gccttacggttaagtttatttcttttacatttttttttcatttagggttg

aaaagaagtttgagataccttagaggtggcatattgttataggtcaggtt

cgtaaaaacagaatgtactgtgtaacgtaacgtgcaatgtcatggacatt

tataacattttgaatcaagaaaataaaatatgaaacaagacatggtcaat

tatctttcaaaccacaagagttaaatatgaggtctgcgatctttacatct

tctttgtgtctttgtgaatgaatgtttaacttattttacccatactaaag

catgtgtgatgctcctgatgttgtcagtttttgccgttttattaatgagg

gcataattatgaaatgttcaaagctgatttgagtcacatcaacatttcac

tgttgtatgtgagaaaagctgttgtcatatgtacacatggaaacttaaag

cacgggcctcacttgtcaaaataaatcatttaaatactcattttgacaac

acagtttgcgttgcactcttgcagtactaagttttttatttggtactttg

atctgttactttgctgaaggctgatttatgctcctgcaacgtgtgatcga

cgtgacccacggctcctaccttgcacatagtcatgcatttaagcttcaga

atgctgtttgctttgctctgcaataacatttctgaaacgctagttggctg

tatgtttttagttcctcagtgttgtgtctcttcatgggtttttaattttt

ctgaattctacaagtagctacaactcgctcattcagaggtgggaactgtt

ggatgtgcaacaactttaatcataaggtaaacacaacacaaaggttttca

tctagagctacttcatgggactcgacacatgtaaacgctcgctacaaccg

gtttgcgcggctcttggtcccacccacactggtcacagctaccaagtcga

ccaatcatggagcttgagacattacagtttttgagaggtggacatcagtg

tcgacgtaatccactgcaagggctatgcaactgtgcaaaggctgtgccgg

agaagaggcttgacacagacgtataaatcagccataatacaggaagcagt

gatccacgctcatacaaatattcctgtttttttttgttttgttttcaatt

tttctttatttatttttttacaatcgtcaggaaacaaacacaaacatttg

ggtgtatagtcatagatgttaaatgctctatataaatacacacattacac

attattacattacacaaaaatgaacactctcaaaaaatctagactccacc

cacaaggctaagggcagcatttatgtaaataaaaaaatcatttatatagc

aaaatatacattaaactgaactcacggccatgagaaatcgccagtttaga

aaacattagaagaaatgaaccagagaacatttcctagtcaaaaaaggcgg

agcctcagagccacacctacctcttatgtagcagtcatgaaccattgagt

gtttgtatgtttctgcgaagtttgcttttgtcctgattttgtttcaaatg

acatcatagcagttctttccttgcgcttgagtatatcaggtgctttacca

ttacaaatcactgtgactaatttgttcagcctggcctcagaaaaaactac

aaaacggcctcttttttagatccacacagcagcggcatgtataaaactag

cttctcaaacatcatcatttggcagtggccttatttcattcgccatttct

tgtgtggcgctctgtcactcaatctgtttttctctcctctgtttcaggag

tgagaaagatagagtgtgaaggggggagaggggagagagagagacagcga

tagagagagattgatgaggcagtaagagcagcagtaattactctgtgtcc

attccccacgccggattggcagacggctaatatcacacagacccctggcc

ctgacaggcacccccccaccttatcccccatcacaaggtccagaatggtg

gggggaagagcgtcaccccagcttcatcctgatgctgtgtgggccgagca

tctttcctctcattacgtggctccttgaggaattgagtgttttctcagga

ccggacaagcaaaaattgcatgccgctcttttgaatgcgaggaaatgttt

aaaacccgtccaggcctttagagctgagtacttcctccgctctaattgtg

taatttattggaaaatgcaatttaaggatgacatggaatctcaattgacc

ccatttactaagtgattgtgcctggttcctattgtgtgcaattcatcagt

gtgtgatgttctcatttcatcaaaatgtaatgagtttatgctttgcatgt

cttttggaataacttttttgctgacgtatctaaggctgtggagaattttt

tttttttttttttttttttttttttttaaccaagggttgtaaatcttgtc

tgcatactgtccacaacaatatttaacaagtttttagttgtagtaatagc

tgagaaatattaataaaataaacacttttcaaaaactagtgattacagct

ccaacataaaatttatataaataaatataaatatataattttataaataa

atatatacttttataaataaatataaagaaattttgtcttttttatctca

caatgtggatattcattgtcttcatccccatagtggcatgtaagattgcg

caagcataaattatgaaaaagtttcacagtaaaccatgtattttatgaca

ctacagaacagggcagcacttttctttctaaaatgggaatcactaaaata

agtttgtttggttttttttcgcttcaaaccaagatcactattttctcagg

attttgtaaatgtaaaataaaggctaatatgagtaagctgttgttgttat

ttcttaaacatggtaaaacaacaataattttattagacctgtgtaggttt

gctgctggttaaaatactaaattttgtatagacttgcaatggtggacttg

gtcctggttgttaattcgcagaaaagtgataacatcagaatacaactgtt

cataattctgaagctgaattattatgtttgagacataagcttgccatttg

tcattgacaacattattagatctttttttccactgttaaaatgagaaatt

tgtcattatcagattccttcctggattatattcaacgttatataggctag

agtggttatactgacccagactatgcaattaatcgaaatagaatcgcaat

cacgatttgaaacgctatgattatcttatcacaaaaatctgcgatatgaa

atgataatgatattattcaaattaattaataaaactaatttccccttccc

agaacaaatgtgtgactgccgtctgtgtcttacttgccaattgagtgagc

acagttgagtgataagtgttttgctaaaaagtcaactgaactgatttcct

aggggtttaatgatattacaaaccgaaccgaaatatcgcgatacaccaac

catgatacgtatcgcaaaactctcatggcagtactctcatgccccctgct

tattgttgaggttgacgtcacgtcttggttttccagtggagtacaagaat

ggaattcctgtcgtagactaagcacacgcgtatttgtcgcaactttcacg

aaacttacaaggaataacatttaaaaagtgtggtaatttcacaatgtgag

ggtgtaagcaaaagactgacaacagaactgccaacaaaagtatttaatgt

acaaaagtgaaaccagaataatgcccaaatagtttgccagtgacacttaa

tccaatagcaagcaacagcaaaaaaactatttcagagttgtttcatccat

gttagtttgctgagtgttctgtatttttataattattatctttttgtttt

tataataagctacctgtctaacctgactatctggctaatttaagttcaaa

ttgttaacaaaaaggtaaggtcattttatttgagtttactgtttgctcta

gagaaaaattaatgtttcatttctgaatattgaaaaataaatgtaaatgt

ttaagtaagttaatatctacatttaacagtaagaagttacgatatagatt

atttagctgatgcttgactacaaaattaaatcccaaatcgaaatcacaag

atctgtcaaaaaaaatattttccccaaatcgcacaacattacccagtaaa

catttattttcctgcacaacactgttcactatggaaaaaaaacatcaaat

ttttgtcataattcactgtaaaatgtgattttgttgcgcatgttcagttt

tactttacaactttattagctgttattcatggcctatgcaggattgttta

ctaaagttgacataattggcgggcaggcgcacattctcttgctagtaaac

aaacagtggatcagctcacgtatgacttcgtggctgcgaatacgtcataa

ctttaagacggaaatgacattcttggaaaaattataccttataaatacag

tatgtgacactattaatgccgtttggaggtgtccattttgctgaacagag

cctatataaaacagtataagacttgtgcgtccgcctttgcacttctctcg

tgaccttggctgaataatagaaaagctgaattaagatagcctgcgaggtc

gaaagcccgactgcgaaatgaacgatagcacaatgtgaatcgacatttaa

ttttgtgcatatgatgtatatggaaaatcaatattggcttaaattcagtt

ttggaaaaacaacaaaagcgtatcacttcgttacaaagttatgtttcatc

catatttttaaatgtggattactagcagtcaattttagaagcagaactcc

gttttccttcttttaaacaccctgactttctgtcagccgaacaggattaa

gccctcaaaataggagcgacacccgtatttgcgcgtttcgctgtggtgcg

tgtcaaactcatggagatatccctcagtctgctggtctggggagcagtgt

ttgaaagaagcccatgtctctttaattaaagatatgtaaatgtggcctca

gctggattacattagctggcgtggctttggtaggctgggagagagtcgga

gcccaacacctaatccagactaattaaggattaatacaattgatgggagg

cttccatcccagtgtggaggtccttgctgcagtctgtgactaatctggag

cgctggagaggggatttgagcagcggtgatctgtcagagttttactcttc

agaggggagggagttaccagtttcccctcatgccatttggattgaggcat

aggccttttgttaagctacaataatctgtttgtctcacgcgaaggtgtta

attcagactcgctctataatgtaggttaggatagacacacggcttgttaa

tagtagttgctgttgagctgaggaaacctcttatcctacgtataaacctt

tgagtaacacataccgtaattacatttcacactcggatgatacaagacga

gaattgaaaggaaggctctgcttgtttacacctgaaatagtgatataaaa

aaagtacaaaaaatttgaaaaaaatagcatttttgtagggctgtgtgatt

aatcgaaattgaattgctatcgcaatttgaaaggttgcgatttagctaat

cgcaagaggctgcaatatgaaataactattatttaatttcccccacctgg

agtcattgcgtgactgccgtctgtgtgtgacagtcttgctaggcaattga

gtgtgcaggctttctttcaacccaatcagaattgtgcaaccaaactatgc

ggaacgcccacaaaaaacaaacaggaaagcatggactagttagatgatgg

catctgccgctcagaagcattaatagactaattattattattgaaaaaac

aggacattggtaatatgggattataatagttttaaagtcacaaataaaag

ttaaattttttgataactttgtgtatttcgcgtgcatgcactgctcatga

tgcatgtacgtcagcagtagtaactatcagtaatgtactagaaaatataa

tttgtcctttcattttcatagaacagttatatatagatgcattagttgca

gatgcattttaaagcactttaacgatttaaatccttattggatattatga

cattcaatgggactaaaagcatgagtttacggagaactttacggaaaggt

ttgctagttacaaactagctagaagttacgaagtccctagtgtgaacttt

acctttcagtttaagaaagaacatacgaatagctggtgcaactctgcttg

agagataactattgccatagcgcactacttcgctaaagatgcaggatagg

agatatatacttccgtcttgcacttatttcagccattttgaagtgccaca

gatgtacgtttaacgtcatgatattttagtagcgtttgtgataattaatt

tgttttagacaatataagctacagaaaggatcttatcagccgtattagtt

tgctgagtgctctgtgtttttatatttattattatttttggttgtataat

aagctacactcactaatttgagtttcactgtttgctctatagaaacatga

atgtttagtttctgaatatttaaaaacagatttaaataaatgtttaagtt

aatattttcactttctttttttaactgacactcactgcattttagcagtg

agaagctacgatacagaatattgagctgaagcttgactacaaaattaaat

cgcaaatcaaatcaaaatcacaaggtcaaaaaaaattgcaataagatatt

ttccccaaatcgcacagccctacattcttgtatgtttaaatgggttataa

ctattgttaaattttattttattttgtgtttcgaaggacttaaaagttca

tcaaggttgtatttatttgataaacacagtaaaaacaatgattgtataat

tacaatttcaaaactttattcttttttgggaaaaaaggcagaattttttg

cagcattactccagtattcagtgtcaaacagatgttcagaaacaattaaa

aaatgtcttgatatttccgtggaaatggtacaccttttcaggattttgat

attaatagaaagttcaaaagaaccgcatttatttgaaatagaagtctttt

gtaacattgtaaatgccctcaatgtcccttctgatcaatttttctgcttc

cttgagtgaatgcatttaattctttaaaaaaagggactcaaccctttgaa

ccaaagtgtgcattgaagaataagcacatttaaactgtcaaatccagtat

aagggcaatggagagtatgttgatggtttaaacttaactgaaactgtaga

gaaagtaaggcaagacaaactagcacatcaaaaatgaccatagttaaaaa

aaaaaacctgtagtattgagttgatatacagttaaaaacacaaactagca

cagtgaaatcttggagaatttaaatattgatatattttttttttttgcag

ccagaggctgtgcagtggtatagcaccttggaacactcattgatttttac

tgtgggtgacgacacgttgacagttcctagatggcaaacgagtcgacgtg

tctccagctctccaatgtttgcatccacatatacacttcagtgctagaaa

caaaaccaactgcgttaaccatttaaaaaaaaacactcgatgcacattaa

caaccctgttggaccatccacccaatcacacacatcattttattaatggg

gttacaactttttttgtgggtgttttaaaactgtagtgattaaaactggt

ttgcgtcatcaactattcctcatccgcccttccaacagaacctgtcctct

cttttactcggctataaataataaaaaaggccaaaaataacgctctgaat

gtacttttacgattgcatggcgagcacagggtgatgcagttgaacgcttc

ggtctccagcactgctgctgtgtcagttctcctcccctgttcttgagcgt

gctgtgccgttcacctgtacacatgacacaatgcagtctctctctctctc

tctctctctctctctctctctctctctctctctctctctctctctctctc

tctctctctctctcttatcgtgtgtcggcctgagctgcagtgggctaagg

ttagtttacactccccctcagtgcagccagccgccactctccccggccct

gtttgcctctgcatatttctcgttcactcgttataaatgggagccgctcc

tctgatctattgcttaattgccacctaatttgcataacagtgcaaattaa

cgacctctcaaatgagcgttcatttttcacaaggtctttaggagctcctt

aagaggcggtgctaattagcacaggaggcagctgtgctgatgagccgggg

agcgggcgagaggggggcgtgacggtaggcaacggccctcttcctcttcc

tcctcttcctccgagagtgaagtcatctccagacgaggtttcttttgtcc

ccggcgctctgctgcacctgaccgcacagaggtgggaacggtgtgtgtat

gtgtgtgctcacctgcgtgatcttgtttgaccggtccctacgtgcagagc

gaagcctgttgttctgccgctcgggtctatgaaatgctcgttgagttaat

taagagctgataaatgacaagtcagagcagacggcttgtttgcctaaggt

aggagcgctgttcacaccctaatcatatcctcctgtgttgacgctgacca

atggccgctcgttgaagggcgtggacggacctgtgtatgtgtgtgtacgc

atgttggtgggcgagccactaggtgcgtgccactaggcgctgctaaatag

gcctcgcagacgctgcttaacctgagctgcttacattaggaacttaccgg

tggattttgtggctttataccaccttggcactcactcaagatataccttc

ctcgtcgtttctcttaagaaatcagacactaatcctttcacttgtaccac

tgagaaagtctctcgtcaccggtttcttttggattctggatttgaacgtc

tttttagtcgcctgttttgattttcccagtctgcttaagttgtttaagtg

gttttgtcaattgtctctgaaccattaacccttgtgtcttaccgtcactg

tacgccggctgtgtttaagcctgttgtttattctacactgattgtgtcta

aggaaagggccggcttctttagctgttatgaacgtcagcacagctgcagg

ccttcatatgaacacatcttaagttgcgtctggatctgcagttggaatgc

gactttcattttaacgtgcattaaaagctacggtttctcatttcaaatag

ggctgcttaacaggaatgtcactttcaggctaggagaaatgagcttctgt

ggcaatttcaagatgtatttcaataaagttaagtaattgagttatgagct

ttgttcaagatcaggcttgaatgtagtcaagctataacgagtcatttgat

tttgagtatctaccgatactgtaacctgatccgatacttttgtaatacat

aaaaaaaacaataaagaagagcgaagaaacggattcagaatgttccttat

tttttaattctccttattttgacattcagcaactccgtctacaaacaaca

cttctgtgaggtagcttgaatcaagtaataaatatcaatacatctctttt

ggacttttagtataacagtaaatataaaacaatctaatattaaaaacaaa

tagcatctcagcttaaaatacccggcaggcaatcccaagtttacatatct

cacagtttactatggcaatgttgtcgccttcaactttataatacctccag

accgcagacatactcacgatttctgcttcaagctgcttccatgttctact

ttgcagacatttaaccaatagtcaagctatgcgttaaagtttctgtgtaa

agtcaagtggtttatacttctgcgtcaagtgatcggcgtgacctactgcg

catgcaacgcgcgtagctgtgcattcatacttctagatgctgtttctgtt

gctctgctataacacttctgaaacactagttggcagagaggtttttatgt

taatctgtgtcgagtttccttgctggtgctttgttttttctgaacacttt

ctttatgtacaagtggttcaaactcgctaattttgaggcaggaaccggca

gacgtgcaacaactttaaccttgaggtaaacacaaaataaaatttttcat

ctggagctcctttacaggacttgacacttgtaaacactggctccaactga

ctcgtcagcgccaccaagccaaccaattacagagcttgcgctacgcgtcg

ttgcgatatgtagatacatttttggagaggtgcactttaacgtcgccgac

agccatggcaagggctctgtgtccacactaaggctgcgccgtagcatgca

cgtgcgcttgatgcagaagtataaatcagccccaactctgttccaccgca

taactttggatgggttaaaaaaatgactatgcataactgtataaatgttt

gggatgtaacatctgattccgatcaagtctaaaactgcatgatcgagccc

aatttcaaatcacgtaatcagatctggacatcctaaattttttataatga

ttagtatttttcaatatactgttgttattttcacactaaaacgtttcttt

cttagactatggcttaatttggcctttgttatttgtattttattgatata

taaaaatattatttataattgatttattgagaatgcagtaatgaaattca

tatggtttcgggtcagtacaatttaaaccattttaccttgttttctcatc

aaataaatgcaaagttattacaaataggcatgggacgataaccatttttt

taaggttgttttgtttgttttgtttttttttttttacatgttttttggtc

attattttatttcgtttgtttagggtaatagtatctccagcaaaaaaatg

accctccacatcaaaagctgctgtttaaaaatattttaaatgtttcttga

aattaaatattgtattcaaaaggtaaaaattgttgttttttatccagaca

tttaaaaatagtatattttggagcagtaatcacaataccgtgatttaaaa

aaaataaaaaatgtatccaaggttattgtcacaatcttataccaggccat

gcctaattacaatttaaaataagctttcttttttagtctgcttttaagtt

caaatttctgttttgccaaagctaaattttaatcctcatcactctagtcc

tcagtgtcacctgatgcgtcagtctcatttgctgatttgctgctcaagaa

atttctcatcagcattcataaatctctctgctttgctcttctttttagta

ttacgaattttaaaaacaatagcattgattggatttagcatttatagcat

tttaaattatttcaagtatttataaagatgaaataacagctggaatatgc

tgtttttgagcagtatattaagacgtacgtgtgatggagacgttaacctg

cactgcaatgtaagaatgaccctcgtatttcacttggacggtaatggcac

tgcagtcgtttgattttatttatttttattttgaagataaattccccctt

ttttacatcccacttagctctcgggttagcttgtttgtttgcgtccatgt

gggcgtgcttttcagatccctcccccgtcgagttcgccttcctccttttg

atttattggctgttgcggtcagagcgttgtcatttcctaagtgtcgccgc

gcactcgtttgcagcccaccgcgatcatcttcaactctttcctcattccc

tttttttctttcccccagccccctctgttttccatctctagctctcctcc

ttgctattttatctcctcctgtgactcccttttgctgttttttcccccca

caattctcctctttttctctccttaccttctcttccccccttctgctccc

tcgcgctctcccagtgaaaggctgagaatacccaagggagctgatgcaat

taaaatgctaatcctgtctgtctacagagagaggtagagggggggctgac

agcatgagggattgcggctcacatggagaactcgactgaaatggagaaca

gaggatggggggaggtggctgggggcacggagagaaaaggaggcggggta

tgacgggagagcgacccaagccggaggaggaggaggagggcgaaccagag

agaatgcgttaagaggaacagagaaaaagacagacgagagccgagcaaca

cggccgtgatggactgttcctccagtaatgcacagaaaatggcagcatta

atgcactgcttccagcggcgaacacaatagcttaacacatcacctgtgtg

ccggctacctggccacattctgcgcctgattatgcatgcggtcgaaccca

gctgagttgctctgaatatttcataccactcgccagctcctgcctgcaaa

cgcttgcacgtctgctggctttttccactcggccctttcctgcttgtgtg

tgtgtgtgtttttttttcttcttcaaccaatccttcacaaatgaggtaat

tcctccctgagaggagtgtggaggggggggtgggatgtgcgcattcgagt

cgatcattcataaatttaatggagggatattagtgcaacttggacagatg

cagcgcattaaaatgtacattatctcattagcttggcggtgtgtttgtat

taatgaagtgtgctaattgaaagatttagcaggctggctttattaatctt

cttaaaggcctacaaacatttgagatgcggtggcttttttggggctgatt

tgggaaggattggtaagcggttaatgaaaagctgtttgaaagcataaacg

gcgccactatatttatggatgtgtcagggatgtgtgatattgattaaata

aaaaaagcaatgttttgtaggttttttcttttcttttcgatagccataat

taatttatatttaactgagtgtgtgtttgtgccgccaccatggctggttc

aggcctgtcatgcataaataaatgaatatgacactaaagctgccagtagg

tagcagcaatgattcactgaatcattgattcagttcattcaaaatggttg

atttatttagaaacaaagcaagtgactgtctttatgagtagatcactgaa

tccttgaccctaatgactcatttcaaacagatttgttcataaatgctttg

tttgctactgatttccttgatgaaaaggaaaaaagcaagactatatggta

tagaaaaattaattagtatcaactttttactattaaattgaattactctt

aacttagtattagttttgttgacctgtttgtctaaaatacgcatcactgc

taaaatatacatatatatagtgtttatccccccccccatttatgtttaac

cgagagaagatttttcaacacattcctaaacataatagttttaataactc

atttctaataattgatttattttatctttgtcatgatgacagtaaataat

atttgactagatctttttcaagacacttctatacagctaagtgacattta

aaggcttaactaggttaattaggtttactaggcaggttagggtaattagg

caagttattgtataacgattgttttgtagtttaccgaaaatgtatattcc

ttaaaggggctaataatatactaataataattgactataataataatata

ctaataataattgactataaactgtatgtatgtatgcatgtatttatgta

tgtatatatatatattgtgatacatttatcactgttgcaatcgtgttcat

aaacatatattcaggaaaatggcgctctcgcttgtgtgacattacttaac

tgtttcgtaaaacagtctaaactgagagactttagtttgttacaactcac

gctattgactactggcttttccctgcgtttatgattatagccaatattat

tcaggatatccaaggggtcttaaagtcttaaagtgtcttaactcaaaagc

tacattttaggccctacagaatcttgaatttactgaagttttgtatttgt

acttcattttactttgttttcgttcagcaacccaatctggctattaacac

ccatacaatcaccaacaaatctcaataaaacttttaacttgttgtttaaa

aatagcatttatttactgtgcttacaggaacatttgtttaaaagttcttc

atttatttactactaagaatactgccctgacctatattttttattattaa

gttattatttttgtattattaaatgtttagaattataatcattgttttat

aaggcaagtaaaaatcttttacaactaatatattttaataaaacccttag

gatttagcccttgtataagtctaaaattttattcaaaatgctcttaaaga

tgttttaaaaggtcttatatttaacttggtaacctgcagaaaccatgtta

tttttattttaattactcaccctttttaataataataataaacttaatat

agcacctttaaaagtagcatctcaaggcactttgcagacataaaaatgtg

cagcagtaaaagatgcgtacaaggttgaatcaaagaaaaaatgtactaat

gaaaaaataattaaatgcatacatataatactaatagatctaaaaatagt

tctccccttacatactaagtaaaaaaaagattaaaaagtacttagggatt

ctgcattgtgaatatcggagggtaaagagttccacaatttaggtgccatg

aagaatgcccggtcccccatagattttaaccatagattttaacagatttt

ttttgactgagcagtttttttaaatattgtggtgctagactattcaaggc

cttatacgcaagcatgaggattttaaaaccaatcggaaaactgacagaaa

gcctaaattaattattattatgattaagattactattattattatttatt

aagcatcatcttaatcgacatccctaatcctacctaatacttctacattg

ctattaattattagataattagttaatggtttgttaatatcatgaattga

ggcctgaagtaaagcgttaaaaccttatgaataatccttttaagaaaagc

atacacactgtaaaaagaaaaccacacagctttgttgttaaatgaaaaaa

attatttggtcaccccaacttgcattactcaaactaaaaattcaaagcta

actcattaacttaataaaataagttaaagtagcaaaaacagttgttgtca

tggctttttgtagtctatttttcacagtgcagaggtatatttactttcat

attttgaataatatggtaattttataattgatataatttttttattattg

atgtaaaataatagatttgttttgaccagttagtgatttttgtagcccta

agacatgttttttttttctttaacgttttgcaaagtgcgtgatattttca

gtaatgtcgactttcatcattaaaatgacaattacaaaaatgatcatcga

caaaaaccactatgattcattaacataagtttcgaaatcaagactaggaa

taaattgacacttctgaagggtgttatgatattccaaggggcccatatca

tgcagctccaaatgttgctggtcatttgtgtaattatcagtaatcacagc

ttaattgagataattaggctgaagaaaaggctgtatgcttgagggattgg

gctggaggcggctcttaatggatattgtgggtgatactctttggggaggt

ggtaaatttcactctattgattgtggggctgtggtcgtaaaaacaacagc

cctcccctcaccctacacacacacacacaccacacaaacaaccacacggt

gagtctggataacaggacagcagaagtgttgttttaagtttaggcttgac

acattctcaacactttgcaggcaggcgacaagctcttgttgttgaagtgg

cactaaaatcagtgtggtgccatattaaatgtgccgtttcacctgataat

agtcacagtaattagcttgctataaacgtattaagagtattactattgtt

ctccggcttgggtttttaaactgttgctcttcctaaataggtggcatgaa

taaggacactgctctttagtgcctcttgtggttatgcttagaataaactg

taatacagttgaagtccgaatgattagcccccctgtttattttcccccca

atttctgttttaaggagagcagatttttttttttttttgagcaaatttct

aaacataatgctttaaaaactcatttccaaaaaatcatttattttatctt

tgccctgatctaaataaataatattttactagatattttgctagatttac

taggggggtaataattctgaccttaattgtatatatattttttacaattc

aggtttattactgtatatgcaagcatatactcattacacaataaaattgt

ccttgttttattataacaacaaatgataataaacctaaacctaacattaa

ccctgatgctattaaccatatagtacataactgtagttgattgactcttt

tttttttaactccaagaaactgtataatacaacttaaatacagtaaaaga

gaacagttattttacacaatactcacattagataaacagaaaatctattt

aaaaatatattaatgcaataaaaaaataattcaagtagcatgaaagatct

aatatttactcaaagacacacatttctttttatcaattaatctaagtgat

ttaattaaaagttgtattttacataattaaaaaaaaagattttttaaggt

acctctgtttgtgaagtaaaatttccaaacaagtataagaaagttcacag

tggcttcttacaacttgttttgatttttgaaataacaaataacgtccttt

agttgcaaattaccacttgtcttaaatccacttcaatcactccaaaacga

taatactttgcataaaacaaaccagtgacgaatgtcttcacattcattct

aacaactgtaatataattattaaaataatcaatagaatgaattacatggt

tcacaggtttattagaaaatgtaaaaaaaacaacaacaacagattagttt

aactgtttttaatctactttattataattatttagatagagatacaaatt

ataccaaattaaatttgttataaaaaaaaacatttttacaacaaaattag

gctacataaaatgtttagaaatttatgttgtttcctgttgctatttttgg

cttttaatttttgtttattttttcagtctgatcaggtaacaatccaaagt

agttcaaaaattcactttgagtcattctttttaagagattgtcgcggttg

tcgcagctgctaaatcatattaacaggaacagaaattaaccagttcagat

gtgcattcgagctgaagcgttagaaagcatgcaataggctataataaaag

gctcgaattcacagttttgcaaccttttaagggctccacagaataacaca

ataaaatggtctatttttgcacaactatgtgagcattttagtcacttttc

cacatgcaacattatttattgtaggttagggttgcactgtttaccggtac

tatgatgtactatgaaaacactgccggtgatactttagtttgtaaatgtt

agtatcgtcatttatggtttccgctacattcgttcgtccatgcaccacac

caaatttcatcccgccatggctacattacagctactcatttaaaagattt

agttgttgttgttgtttttttttaatagctggttataactgcaccaaaac

atattaaaaggtaagtgaattataacagaacaaacttttctgtaaccgta

gtagcgctgtgcgttatttgtttaaccctttatggtgagatgttgactga

ctgacaggtgcatgaggctagcaatcatgacggctttttgttaagatgaa

cagtttctatagttgttctttatagataaaggtctgtagttctgcatgac

cattatttttcactcttttgttctataaatgtaattactagcttgtaaaa

tagtccagtggcttcaataaagatgtttcataaaccctgtgtaagtgtaa

gcacagtcatatgaagacttgaaatcatatgcagcgtgttctctgttctc

cctgtgaaatgtatgtaaacaactgaatgtgttagttt

hi933 (3-5)

cagtaacagtcctgcgactgaaatcactttgactggaaacttgtagtgta

gagttcctcctttttctgcttgactttggtgagtttttcgcgaggtaaag

cgagggagggctggtgaatcggggtcattagttcattcggctgggtctgc

tgcattcctgagctcagagagggggagaaaccagagctggaatgtgactc

acagagagaggagagagaagagggaccctgaaggggcaagagagaacacg

aaaaaaaaaacaccgcttgccaaggcgaagagaaaaaacttttcagaaag

gagcgaaagggggggagcggaggccagcgtgattgggggagggtgaaatg

tgttatcagttaaagggaggattggaaatacagctttgatttctgcgggg

atggtacagacagaacatccacacacacaacacacacaacaaatggccct

ttatttgcaccgtttgtggtcgaaagttcgcaaacaaaacaaaactcgat

gcactgctggagtctgtgctttcacaggagtgttcagagctgaatcattg

agtcaggagagattttcttttgagaaagatgccctctgttgagtaatcct

aagagttgactcattgattttaatccagaagactgacttttcttttcttt

tcttgagtcaagttcatcaagtaaagaaatcatttcactgaatgagacct

caatacaatacaaaaagatttttacaaaacaagtaaaagaggtttggatg

attcatccgctttatttatttatttttttgcaaaatagaaatgtagaagc

cgagacatgttgcaaagtatcccaaacaaagtttttgtttgtctttttaa

acacaaggatgattgaatttacttttttttaggtccactgtaaaacccaa

cagtcaactttatcaaatgaaatgagtgtagttcactcaaaattgactgt

aaggtaattacattacatacattacatggagtaagttcacatatagatta

gtagtttttttttacttaaatggtttgtagcaaacggtttccttaaacag

tttgagttaccttagctttgtggattttatagtgtagctgtcccttttaa

tttgtaaaaactatatccagcttttagagagaggggaaagagttcttgtg

tgcatgtatgtgtgtgtgagctctcacaaagaagaactctgtttcttgct

ataaacatgtagttgtttttaaacacacacacacacacacacacacacat

atatatatatatatatatatatatatatatatatatatatatatatgctg

ccttgaaaagattaattttctttaaaagaaaactacaatcaatttagctt

tggacctgtggggaaaacccgagcacccaaaggaaacccacacaaacaca

gttagaacgtgcaaactccacacagaaacgccaactgacccagccaaggc

tcgaaccagcaaccttcttgctgtgaggcgaacatgctacccactgcatc

accgtgacgcccaagagagaataattctctcatttaaaataagttaaaat

taaataactgtaactaaatacacttgatgtgttaattcaaaatgcaatta

aaatgaataaaaactatagccacttaaataaaatgcaaaactattgcatc

tacatctgtgatgtaaaataatgcaaatttattaataataataacattat

agaaactaaagagatgtcaactgtttgcaattcgttttctctgttttata

ttattgataagtatttagtaactacaatagtgtatcaatcttacaaaaac

tgctctgtaatacttctgtttttaactatatttattttacacacatttct

aagtgccattactcataagtaggcccacatggaatttgcgtgcagatttt

tataattgagtcgatgtatttacttaagtaaatgtgtgtcaattcatatt

tgttcagtttttaaattcatttcactaatattagtgtggtatataataat

caaaataataataataataatatgaaaatgttcatatgatttatttacta

tacagtttgtaaagtaatgtgttctgtcttttagttgagatattatatga

gacttgctttgttttccaaataagtggatctagatagatttgcatcataa

agattaaataaaagttacaaatgtattattttttattgtataaattaagt

ttgtagttatgatactcctaaaaccattcagcattaatccacagattttt

tccccccaaaattctcatcaaaaatatctgcagattcaaataaattctat

atttacctataaaaagtgtctgtaaatgttgtataatgtggcatttccct

ttgtacatcaacctctcatatgtctctctgtgtgaaagtgctctagagca

accacaaaccctcttcggtgggtgtcatgtatttccacacataatcgctc

tcacgctttggcctcagtcaccgggcagctctgcgtctgcatatgtatgt

gagtgtggagcgagtgctcgtataggtgtgagcgatgggcctgaatcagg

aagatgacagaggtcttgctttaattcagtgccagagaactgtgtactta

tggctgctggtgcttgtagtgacagcacatgctctcctattattggacct

gtgccttacactctggcctgccaatgaggtgccatgctgccctctgctgg

ctcacaggggatttgcatactttttttttgaggtagggggaaactagggg

caactggaacactgttatacgttttcctttttcccccctgatgtttgttt

ttcttttctataatatcttactttttttttttttataaaaaagattttcc

ttaaattgtttttgttgcaatgaatcttttcaaccatgataactgtaaga

gttaaagcagcctttcttttaaacaaaatacaaatattggtgcactaatt

aataatacaactgatatatttacgctaacgaggactgtaagactctaaca

ttaaatgatatgtggaaaataactgatgtaatggggtatatgcaaccaga

cttttaatttcagtcaggcagcccctgggcttctggttaattgtcatccc

atacaaaaacgcagtgtttaagatctgatttctaaaaaaaaaaacacaaa

aaaaacgcaatcttcactgcctgaatgagatgcgatataaagtgggtatc

aggccaaacaagaaaccctgtacttaatttcattgctctgaccgtcatgt

ctttaaaatattgaaattaattttaccccagtattttttatgaatattct

gcactagcctgctgctaatgacggcacctgcattaaaaacggtctttcgt

ctctttttgcgttttaacaaccaattggatgtggtacattacaacatcga

tgctgtaaaaggaaccgtatgaaattgaaaatattcacattaagctttca

ccagaagttcatcatgggctgaaaaacactagccgtgcatatagcccata

accctcttggtaaattgtaacactaaaaaagtagcccacccatcttaaaa

taaaataaaatcttacatcaaagtaaacactttattacagtagtatttat

tgttgcttgaaagtgtttttgtaaatgtttccaatttcagttgtcattaa

tctaattttattttttgcagaaaccaagtcaactattctagtggtctcta

gttatatatatatattgtcattattttcattgtatttgatttgttttgtt

tgtatttatcttttacttgggatttaacgattcaccgtgagccggttgaa

aatcgtttaaaaaatgtaactattcaaatcagtagaaatgttaaacgact

tgcgatgcatgttttgaacaaggggcgctgtgtttacaggcacaaacttg

ctttacatgtatataagcggcgggcgagaggtgggatggcagactacagc

cgtgaaggtcgccagacaaaaacacaaactatgtgcaaataatgcaaaac

ggcgtttacttacactaacagatcaataaatatgatgcacataaaccttc

agaatctatattcaaaaaaactattaataagtcattgacctcctgtacac

cctgctctctggtttaggaaaggcttacctctttgcagtcacaccagcca

tctccgtccctagtcaaagagtttttcatctgcaggggacacgtacagtt

gaagtcagaattattagcccccttcgatttattattattatttttttctt

ctttttttaaatatttcccaaaggatgtttaacagagcaaggaaattttc

acagtatgtctgatcatattttttctcctggagaaagtcttattttatgt

cggctagaataaaagcagtttttaattttttaaacaccattttagggaca

aaattattagcccctttaagctatgttttttttttttttcaatagtctac

agaacaaaccatcgttatacaataacttgcctaattatcctaacctccct

agttgacctaactaacctagttaagcctttaaatgtcactataagctgtc

tagaagtgtcgttaaaaatatctagtaaaatatgaattactgtcatgatg

gtaaaggtaaaataaatccattattagaaatgagttattaaaactattat

gtttagaaatgtgttgaaaaaatctgctctccgttaaacagaaattgggg

gaaaaataaacaagcggtctaataattcaagggggctaataactcttgac

ttcaactgtaaatgtaataaaacctcagtttatatcagaaaatggagata

tacagatatctctttttttttaaaatgtgtaaaatcccagcacattgtta

gtttgtttatattaatgagtcttctttagtttgtattacttgtataaatc

atgactgaagcgtgagattagtattgtaaatcatatggaatcttgagtcg

ggtgaattgttacattcttatcttttactcaatacaatgatcagccgatg

ttaacaagcttaaatagatgcgagatatgaactgagaaacccaatgagat

catgtggacattcattgtatttctttttaaatagaattggctctacatgg

tttatcattggagtgatttaaatttggctcttgtttcctttgtgccatta

tatgctgaattttatatacatgactggtttcagaaagctgaatttgactg

ttgtttttgtgttttgcagTGCTGAGCATCAGAGGCGTGCAGGAGGAGGA

TCCTCCAGATCCACAGATCATGCGTCTGGATAACATGCTGCTGGCTGAGG

GCGTCTCTGGGCCAGAGAAGGGTGGAGGATCTGCGGCGGCAGCAGCAGCT

GCAGCAGCAGCTGGAGGATCACCTAATGATGGCAGCATCGAACACTCCGA

CTACAGAGCCAAACTCGCACAGATCCGCCAGATCTACCACTCCGAGCTGG

AGAAATACGAACAGGtcagagcagtgtttcctctaggattttttccagct

Gtggcagcaggcctttt