UDP-glucuronic acid decarboxylase 1

cDNA: Genbank AF506235

 

hi954 and hi3357 are both in the 5' UTR

 

ctgcagcccaaaagcccacagaaactgaaatgaagcacaggaggagtcgt

caacgtggaaaatcactgaacatcaacatccctccactcatgttattcat

gaatgggccactgttctcaaggtgaataaatctgtattcgattactttct

tctgacgtcgcacaagacagtattcttaaacaaagcgtcttttgtttgtt

tagtaacatatactggaaataaagtattttttcagacagttttcataaaa

ctgaaagcgtaaactaaacaagttttaatagcttgctatcacgacaggac

tgttaatggatAGCGGAATCATCGCTTATGTTATCCTGCTCCGAGAAGCT

GATATGGAGTCGCTTTATTATATTTAAGACACTGCTGGACTCTTGATTAA

TAATACTGGATTATCAATCAACCTTGACCGTTGGACAAGGGAGGATTTAA

TCAGAAGCGATTGTTATTGCGTAGCATTTTGGTAACTTGGATAGTTAGCA

TCTTTAAGCTGCAAGTCTAGAGTCATGTCGCTAAATTGCTAAAGGACACA

TTTCATATCTACCCACCAAAATGCCGTTTTTCTTCCTTTAACCGATAAAC

TTGGATTAATGTGGACTAAAGCCGAAAATAAACTGCCCAGACTACTTTAA

CTGTCGGATGCTTTTTGACGCAGTAATAGTTAGTAAATAAGTTAGCATTG

CTAGCATAGTCGTGCAGCCGCTCTTCAAATAGAAACTTC

hi954 (3-5)

CGTGTTGCACTACGAAAGTCCGTTATCGTATGTTTTTGGGGCTGTAAACC

CGAAGCGAGTCTTCCTCGTGTTTTATTTGCAAG

hi3357 (3-5)

TATCAGGCTTGAATGTGAACTAGCGTGAGATGCGGTGGTAAAGAAGAGTT

CGATGCCGTGTGTGCTGGAGGATGATGCGGATGAGCTGGATGGTCACAGT

CATTAACAGAAGAATGATGAAGATCCTGATCGCCCTCGCTCTCATTGCGT

ACATCGCCTgtgagtatagaaacctgatatgacatcaagcacacctattt

gtctgcctgtctgatgttaacgttactttggttctgctgtcatgagtaac

ttggagatgtcttctagagaagttatgaagtgtaatatgttttaatgaaa

gcttatggaggtttattagtacattttctctcataaagtgacacagtcat

accattttaagctatagtgtcagatgggaacactgtggtattacatgttt

ttttcatggctcttcaaatgataacttgccatgttaatatgcatcaaatg

ctagatatctgtttttggtgattgaggtaaagttggtttcatattcacac

gttcagactttctccttaataatatactttcagaatattgaaaataagta

agtgaattcgacttcgtcgcccgtcg