exocyst complex component 2

cDNA: Genbank BC056782

 

hi96 is in the first intron, before the ATG

 

gtttctgtcatgtgattggtcgtgtgggcggtgccgctgcacccaaaccg

gaactatttttcagagaaaagaagcggtgcatttacTTTTCATTGCTTTA

AGTAAAgtaagtaatggcgttgtttttctactccactagtaaagaagcgt

tgttgttattatgaggtaaaatgcttgtctgaattaattcgtcgtcgtcg

cctcgccattattgtcagattgttttttagcattagccagtgtgct

hi96 (5-3)

atatgtcagagcccctgtttatcttaatggttagtttgataaattcgcta

taatcatcaccatcgcgctatgtgcacagcaaatacgccatgcatttact

gttattttgaaacagctcatttttcatttaacgaataaactgcctctgtt

aaggctctccgtcattgcaatgtttaacgttacatacagctaacgttata

tcagtatcaattttcatgcataatgattttaacaaggtaggaatgcatat

gtatcttcaattcgatttgactgaagcctgataacttgattttattattg

tgtaatcagtatcatttgtttcatttagtgacagatgtaacatcttgttt

tgttttggggtctgaaaacaaaatgagcattcagacatgatctgtttttg

ctttccttccgtctcatcttcagttttcttttaaatgagtatcagtgtta

aataatagcagcaacttaaaatgcaacccagaactccggcttcattgctt

tttatttcttttgatgctcgatataactgcagctgaaatcataatgtaaa

ttaaaatcagatcatggttaactctcagtgatggtactaatgaattgttc

gtttttcgtttgtttactattgaaagcatattttctgttttgtgtttttg

gctttgactttgttctctgacactgcagattgaggtaaagttggttttat

attcgcacattcattcaattacagattgtgacatgctccctacatggttt

accatggttctttgaatactcagactagggctgctcgatattggaaaaat

ttcacattgcgatattttgttttgctgcaataatatttgactagatattt

ttcaagacacttctatacagcttaaagggacatttaaaggcgtaactagg

ttaattaggttaactaggcaagttattgtataatgatggtttgttctgta

gactgtcaagaaaaaaaaattgtttaaaggggctaataattttgacctta

aaatgttttataccaaaattaaaaactgcttttattctggccaaaataaa

gcaaataagactttttccacaagacaaaatattatcagacatactgtgaa

aacttccttgctctgttaaacatcatttgggaaatatttaaaaaaggcaa

aaacattcaaatgagggctaataattttgtctttaattgtatattgagat

atgaatataatgatgattcttttagctctatttgtaaagatttcattctt

ttagattgatgtgtgatgaagtcttttttatatgcatgcagtgcatttgc

ttaaatgattataaattgccagcaaaaatggttttctggggagtctaaca

gtattcaagtagagaaattgatccatcaaatgtaaaataacatggtcatc

attgtataaataataataataattaaaatatatatttaattttttactct

atagcaatgatctaatcctgcgaagtgacttgcggatacacacattgcat

ccattgatatattgttcagccctaatttagaataaaatgacatgtagctg

tgacttaagaacaacattagcactatttaattgtctgtgaaaaatgttgt

actttgatagttgttggctgctaatagagtttcactatttgaatgttgca

aacaatacttttctgaaattatattatggagaaatgtgtgtgaatgtgtc

agtaggctgtagaactatgtgttgcatacacaagcggataataaacaaaa

acaactatagaactgcacaatctaacgtttcagcatcaatattggaatgt

gtgcatttgcaatagccacattgcaaccggagttgggattattattgttg

atcagcaatgaggaatgtacagtgcttacattatactatgcatttaatta

ttcaacaggggcaggacaaaatagtgatatgcatgaggtgatgcttctcg

ttatatagtctcatatatcaatggtgcaattctaagaactatatgtgctg

ttaataaaaaaaaatgcatcctaaatctttttgatgtgttatccactctt

catttacaaatatcatgatatattgtggatgtttttctggtgatatattg

ctcatatcgtgatctatcataaccacgggcaaaatatcatgataatattg

tattgtattactgtacctgtatatccgactacttatttcacatttatgtt

aattatttattcttgcaatttttttaattcactattctacaagaatattc

cagtcaatctaatttaatgatttaattccaaacagagctattaaagtcat

ctgccaaaattgtattaaagcaaaataaaatattgctgtgtcagattttt

ttttttgtttgtttgttttaaatattttgcagccccactgtcttaaaaag

caccagccacaattatttattaaaaatttttttttgtaattgtcaaaatg

cagtcagtcagtatggtgctctgaagctgaatgttttgtttaggcttctg

ccattatatctggtggatgtgaagtgttgaattgtcctgccgagtgagtg

tgtgctgtaggtcgggggtcactgtgtttatggagggggctgagtgttga

taggagggtcgctggtaatttgtctgagacaagctctttattccatagag

actctcaggtgtcagtcgtttaagcagtcaatcactcccaaatgcttaat

gccacacagtaagagtgtgtgtctttgactttgactattttcacttccaa

aacatactattttgttgtaactgaacagtaggatccccttttttctctct

gttttaatttttttaaagatacattgatggttctgagctgacatttgtaa

taaacaataaataatttcatagaaaacattttcatgtgattttgataaat

attactgaaatgtatggtctttagtttgtgctggaaaaaaaatgctgtag

aaaagctttttgttaatgtgggaccagatgacccagttaaagttatttac

atattctggttatttgcttattctagtcatttaaacatttattataaaag

taaaattaagtatttttatagttttgccattgcaacattttgtcagcccc

taaaaattaattcattaaattttgttacttggacttaaagtcttaaatct

atacaataaatccagcagaacctctgtttaaacaaaagaacaatgttata

aatttttaataaatatattgcagttctttatacgcagctcctctgtcgta

taattaaaaaaaaagtctccataggctgcaggttgcatacaatgattgta

agaggataggtgtagtgcaagtgaattattttgtaaggtaagagttcgat

cgatgcgctttgatgagaaatttgatctatacatttatctgtcaattgaa

gaattttcagaatatcattttaatgtgttgataaatccaaggcttactga

agtcaatatcagtcacctttgatgaaatattggcataactgtctttttaa

tgtatactctgttgtttgtattgtttagtttgtctttagtactattaaac

atagtgtctagaataaagaatattattataggtaaaatagaaaaacaaag

cagttctgtatgtgcattgtgtaatatgctgttataatgtgtaattatat

agttacatatgtaatatacatctgtttgtacagttgaagtcagaaatatt

agccctctttgaattttttttcttttttaaatatttcccaaatgattttt

aacagagcaaggaaattttcacagtatgtctgataatatttttttttttg

cagaaagttatttgaaagccattttaaggtaaaaattattagccccttta

agctatatatatttttcaatagtctacaattatcgttatacaataacttg

cctaattaccctatcttgcctagttaacctaagtaagcttgttaagcctt

taaatgtcactttaagctgtacagaagtgttttgaaaaatatctaatatc

taatatctaaaatatctaataaaactattatgttttgaaatgtgttgtaa

acatctttgtaaacacatttctttctctttttttaaaggaagctacttta

taggttatttctttgttcatttaaaaaaatttcattgttgtcttattgat

cttattctgtaatgtggaagtgcgctcatttttgtggttatctttagaac

tttcaattcagttgcctatgggagaaattaataggaaccatttatagcag

aaaactgtcaaactacttgttctacaaacaaagatgttcatgcctataca

taaaaagtagaataatataataagaaaatatcagtttgcaacatcaagaa

gcttaaactgctattttagaaaaaatcaatatggaagcgaatgagactgt

ctcaagctaaaaagattccaatggctgcgtccgctcgtacatgaagaata

agggcaataatactttctattttttattaaaataatgccctcttctcttc

cacccaaaatatcaaaatgtattttaaatccaatttaaaaatattcacat

aacatttgaactatagacatgggactttcaaggtatactgcggtttggaa

aagtccattcctatggtatacatgtatgtaagattttttttgtttgtttt

agttttttaggacaacagtatctccagcagaaaacaaaatacccaaagat

gccattttcaaattgtgaagaaatctgtgtttttgaactaatgaagagag

cagaagtcaatgattcatttaaattttttagcctgacatgtttactgctc

ctaaaaatgttaaatgtttctcagcatatgatattttgtgttcaaagggg

gaaagagttttagttttttttttacccatacatttaaaaaatatatattt

tagagcagtaatcagaaaaccatgaaaccatgatatttttatccaaggtt

atcacaccatcagagtcttacacctctcattcaaactttaaatttgatgt

aaattttaaataaaataataaaatatgtgcaaaaaaaaaaactaaataaa

accaataacatcaactaatatctaaatttgtcaaagtgctcacatcgctg

cagtgaatatatgtctgagtacactgatagactgagtttgcattattagt

tgtggcgggacgtcttctcaatccgtactgtggactctgtggtctgctgt

agaagtcaaccatcaccatgtccccctttatctctctctctggcccatac

cagagaccacacatacacagaaacacaccctctaggaccacacagagaca

gccacggggtcatgcacgcaaaccgccctagagctgtcagtcttgagctc

cgtctgagtgtttgtaaatgagagaatgtttgtgactgagaaaaagccga

gttctgagctaccgtagtaatattgtatgttaaagctgcacgcttctgga

taaactgggaaaaaaaattttattatacaaatacaaattatttttgtttg

tttgatatagtaagatcatcagtctcccatgatttcaaataaattgtaaa

taaaatcttaccgctttaaaattgttttgttgaaatttttctagtcttct

caaactaatcagactgactaaatattttaagttaagcttattgtcctgtt

ttaagttgaagtaacaaaacatttgttgtcataactttgtcatataattt

tttttaagtgtagacaactttaggacaaaaagaaattgtgttgattttta

tttgctgcagtctgtttttataaaacatattattttattagttcatttaa

ttttttaaacactcagttcagttcactcactcacactatttcataaagag

tgaaaaagcttttgtcagaatctctattcagtgacaagtacatgtttatt

agtcgcttgttatttattggtggaacagtgtaaatgctacactatcagga

ataaaggtacaagttctattactgggatggtgccttttgaaaagagacca

ctgtagttactgcacttgtgtctttatttctgagagtgtagcaacattct

tttaaacttgcgtttaaatggtggttgatcgctattgtagatgtcagtgc

ttgtatccaacaataaactatttttatcccagtacttggagctaaataca

aaataaatagtaaactaatgctaactaacaatactgattgaaaagaccaa

agactgaagctgtttcaaccatacattatgactgctttttctgggtaact

catcttaaacaaaacactgtctcatttagGTGTGTGAAGGATGTCTCGGG

CCCGCCAGCCTCCCTTGGTGACAGGCATCTCACCTAATGAGGGTGCGCCT

TGGACCAAAGTTACCATTCGAGGGGAGAACCTGGGCACCGGACCCAATGA

TCTGATTGgtaatatacattcacagcataatatacatgcacaattgcaag

taacagatacacaaacccttgaaaaaaattaacattgaacatttttgtgc

cggtaagatttatttaaataaagaaattactacttttattcaggaaagac

taataaaattgatgacaaatggcagacaatacttagataaatactttaag

ataaaaaaaatacatatttctgataaatgctttttgtttgaacttaaaaa

aatcttgaaaaaaatcaaagcctttttcaacctaaattttaaaattgtat

tgtaagcaccaaactgttttacatgtaacaatgaagactggcataacggt

gctgaaaattttgttttgcacatgaaagaatttaaattaaacagaaaatt

acttttatgtaattataattttttatattatattattttattttatttta

ttttattttataattaagctgcaataaactataaccatgcaatttggtga

caattacttgacctaaacatcaacacacatgaagttgcatggccatattt

tattgtttaatacttatataattaatacaatatgatataattataataat

ttaattccaatctatacataaataaatgtaattctgtgtctttagtttgt

aagaaatgtctttgtgtgttagcttgcttattttacttaattacgtccat

ttaagtacacatcattgtaagtgctgtagttcaaaccactcactttccac

tgctgtttgtgtgaatgttttcaaactatagacttggagaaacacagact

cctcaaaacttgttattaatgacgtaatttgttttgctaacaattatttt

gggaaacacaccccagagctacgaaaagaaatctgattaaatggcttgat

tggctcttgacggtcagatggcatcagatcagcaaattaagtgggattat

atattggacatgagatgagccagaattgtctgtttaattgacttcatctg

gtcttcgttgctctcccacaccgcagGTCTGTCCATCTGTGGTCATAACT

GTTTGCTGACAGCAGAATGGATGTCTGCAAGTAAGATAGTGTGTCGAGTG

GGTCCTGCTAAAGATGACAAAGGCGAGATCATCGTCACCACCAAAAGCGG

AGGCAGAGGGACGTCCACCGTATCCTTCAAACTGCTCAAACCAGAGAGAA

TCGgtgagcacaaacactcagtgccctcaaacacacacatacacacactg

tatttacactgttattcttaaactgttcgttcctaatgataggttgtaat

taggcatgggcttaagattctgaaggtatgagatcctttgataaagatat

tactgcagactactgctctaaaatatgttctttttaaatgcctgggtaaa

aaaaaaaaaaacttttattagatataaaggaaaccgctgcactgttcagg

tccatgcttgtatgctagtgcataagggatttaaactttcaaatattagc

taaaacatgagctgagcagtagcttttgatatggatgcttgattgctgct

gggctctagatactgttgtcctaaataaataagatagtctttgacatttc

acaaaaaaataaacttatacatatacaacaggagaggtataacataaaat

tttagtttttttaaaaaccttgactttttcaaagcggttatcaccccatg

cctaactgtcaaggttattataatttagttttttttttgttttgtttttg

tttttttggaaattagatttttatttttatttttcttgaaataacatgca

aaaccatacaattatataaaatgtatacaggttcttcataatttacacat

ttgtttatcaatttagaaaataaataaataattcaacaaccagtaacaaa

gtataaaaaatactaaaaataatagtacagagcataacaggaaaggtaca

ttcacatttcaagtgaggaaatgaatatttcccacatatctttttccttg

gaattatcattcattttggccaacattttctcatatgatacattctcaat

catggatttcatccataatttaagtgtagggcattgaatatccttccaaa

acctcagtgttatatgcgctgctgtagtaatgcccaaaattacaagggtg

aactcatcagttgtaacatttgaaacctcatttttgtcacctaaaaggca

tatcctgggtgagagagggatattaaatcccaaacatctacctaattgtc

ttaacacagattcccaaaagggttgaatctttgtacaatctttgttgatt

tggataaatttgctgtatatttcagtttagttttaattcattttattaat

gatttgttgtgtttagtttagttttatgtttagaacatatttttatatat

ttagtttaaggagttatcagaacacatccactgttgacccaagcaaagtt

tagtatttgcgcagctcacattaactcatgtgcaaacctcatagtaataa

aaataaaatgattgtctgaacaaaccaaaatcatacaaatgcatcaaata

aacgtaaaaataggaagaattcagatgaatgtcatattaaagttcaaact

gtatagtttatcatgcctagtttacttttttggcaaatgaagaaaagata

gaacacgttttgcatttgttgaaaatatgtttttgtgtataatcttggtc

ttgagtgatatgtttggctgtaaaagcgccatctacaggtacttttattt

tatttacaggttttttttacttttatattacagtcacaagtcagtcacag

aaccagtgcttataaattctgaaaatgcttgtttcatttagcttattatt

attattttattttagttagttcttcagtgactgctgttagtctcgtttag

ttttagtttttcatctattgtaattttattttagttaataaaaatgtttt

ttttttgacgaatagttttattcttagttttagttttgattcattaaaat

aacctcggcaacagtacaattattgtctttttttgtaatgcatgtttaat

aaaccaaatgttatttgattggtaaataaattgacaggaaattcaaaaat

aaatcattttaaatttgaatatattaatagcacgggaatgcgatctgtca

agacgtcactcatgcagaggttaaattatactatttctctaatgaattat

gactagttaaataattacataatcaaattctagtgtgcaaaactgccttg

tgtttcatttacagtttttgcattttgtaccatttattttttggttgcac

tacgagattttattagtttgttagttaatctatataataataaacaatat

ttgtacatcgtttattaataatgtagttcaacatttactacagcaatatt

aatgcttgatgcactaacagtaatgttaactttatttccattaactaatg

ttaacaaagatcaataaatacattaaaaaaaggaattgttcattgttctt

gttagcaaatgcatcaactatcattaacgaatgtaaccctattgtagtgt

gctgttcgtattttcttatctgctgtttcgaaaatgaactgaaccatgac

tttacaccaacatgcatgtcaaaccgtaattcttggttggtgttgcacta

cttgatacacgcttaacaatatatatatattttttttactatcagcacaa

tattgttcatgtaaacatgctcaattttcctcataggctaaataattcag

tttgattgatcgcacaccctcttttaaatccacacacactgtctttgaag

atggcagaagatttaaagtggccgacgcatgagaacgctcatgtttctgt

gtgtttagGCATTCTGGATCAGTCTGCGGTCTGGGTTGATGAGTTGAATT

ACTATGACATGAGGACCGATCGGAACAAAGGAATCTCTCCTCTCTCTTTG

AGGCCGGCAAACCCTTTGGGCATTGACATAGACAGgtacagaaacgttta

caagcaaatttgtgttgtcctcttatgaacttacaaagtattacatagta

tacaactatgcccacacaacactgtactcacacacgcacacacacacaca

cacacacacacacacacacacacacacacacacacatgtgcttcatttct

gactctctgattaaaacacactctcacaaaaaccaaaacaaatgcatttc

cacacacacttcaccccaaaagcactgctctatgtttatagaagtggact

gctgtgtttataaggaaggaggttcagcagaaagtagaaacagcccattg

tgtgtatgtcttctacctgggtgatgtcattggttcaacatttcctttga

taggaagtaaaactcttcctttccctgatctttacagcaccgctgacctt

ttacttagttatatctacatattcagaccaaaagtctggagtctgtttaa

taaaaaaaaaaaaaatgctcatttatgcttatcaaggcttcatatatttg

agctaaactactgcaaaaacaaaaatgtatgtaaaacagttatttatttt

ggttattatcaattgcaaaaatgcttttcttacttagatttattgtctta

tttcttgcccaaatattaaataattcgtaaatcaagaagcatttactaga

caagcaacaatattgtcttcattcacaagttcaggttgctttattggcat

gacattttgtacagatatgtataaaataggctatgtaatataataacatc

atcaaatacatagaatatacagcaaatgagaaataaatgacagaaaaagg

gaataaaaacagacaatatctctaaaaatgtaataattataagtgtagat

tatttaaataaggcacattagttgattaaccatttttaatggtgtacaaa

tataaatatttagcagccagtttagatgtcatttcgtcccctttgagtat

atagtaaagtttttctgagtcgtttgttaaagaattaattatttaatatt

tctctcactctcataactttgtgtgctgaatcagctgcaaagctaagcaa

aagtagctttaataaaaaggtaatgtaaaagtgcaaacaatttatgacaa

ctattgaaagtgaaagccaaatatcgaacattaggagatcttgaaacccc

agccagatgcatgttttaagtgccaaaaagacgcatctctgtgggtctgc

agagcatgtgactctgtgtgggagggttgacagttcttgtgcacatggat

ccagtagtagcctacgaaaagggtaaacaagagacacttttccactggtt

aatcgatctcagatatttggttatcttgggtggatataaaaaaagtgcaa

aaggatgatgataataatagctaaaaaaaaagtgttggcaaatatatttg

tgcggccatttatataccttatcgcctgcccaagtaaagtctaaatggaa

agcactgctcttgttctaatatgagaacaaataagtttttcccttaaaac

gagcaaaataatctgccaaacactgcactgcaaaaaaaattcttacttgg

ataatatctaaaatatatctaaatatctaaaaattcttaaatcaagaaga

attttcaagacaagcaaaacatattgtcttgttttcagaaataatatgcc

aaaattaagtgagtttttccttacaacaagcaaaataatctgccaatggg

gtaagcaaaatgatcttgttttttgtttgacgcaagattattttgcttat

cccattgcctcaataataaaaaagcaacatgttttttaaattttgttttc

aggcagtctagcagtatttaggcatgaaaatggagtattcaaatgtaaaa

taacagtagtttttgttgggtgtatatatatttaaataaaatgaatcttt

cttaaagttaaaagcattattctttcttgtgcgtaaatgctttaacgaag

actcaccatgttccgtactctttctgcttaacaattagtgttaaaaaaat

tacataatattcattttaaaaagctgtaatgctgtgttatgcacaaatta

attcaaatgcatatttctttgctcttaaaatcccccatcctaagtgacac

tcgcaccttaagcttacccactgttcatgttcaagcatattgggtggacg

tagcaaacttactgatttttaccaaaacatttggtagaagagtctcggtt

gtgatcggggatgaaagagtgagatacaaatattacacagatacatagct

tgtctacaacctgtaagtatttattcaaagattggtgttaaaaggtaata

tgtacggaacatctttgtgtacagagcatggtttgtctacgttaaactct

tacacaatcacacactctaaaaaacccgatcaactgaatgctcctggtta

actataatcttgattcaacgttgtagacttcgcaatgtgacgattgcaga

ttgcaatatattgtgcagccctagtattttctcaccaaacaaactttgtt

aatcaattgcaactttgaaaaaataatcaaactctctgtgagtaatatga

attctgtctgtatattctgtgccacatcataagacacagtgacttatgta

atgctttttgtatatgaaacggctgtctgcttttgccttgtggtcaacat

agcattgtggagcagatgctctgttatttctgtgtgtgtactgtatgtgt

gtgtcttctgttcatcagAGGGAAGGTTCCTTTGAAGGATCTGGAGAACA

TGTTTCCTGGAATGAGCGGCGATTTCACCAGTGAGAATTTCTCTGCCACC

TGGTACCTGATCGAGAACCATTCATCAACCAGgtcagcctgcataccatc

catccttctgttaatcagcctaaatagatatatgtgtgatgttgttgctt

gtgtttggtgctgttgtagTTTCGAGCATCTACGTGCGGGAGTGGGGAAC

CTGAAGAAACAGGCCAGTAAGAAGAACGAGGGCAGTCTGGCGTATGTGAA

AGGAGGTCTCAGCACTTTCTTTGAGGCTCAGGATGCTCTTGCAGgtatat

tttgatggtgatttgggtaatcgattaaaaaatgatatgaaactgtatac

atttgcaaaaatgaaactgcagcatttctgagggaaacagagtaattagt

gggaatgtgtagggttatttaggagacatggttgtgcttgggaagatttt

gttggagttttttttatttaaaatgcatttatctg