nuclear transcription factor Y, gamma

cDNA: Genbank BC045364

 

hi962 and hi2019 are both in the 1st intron, before the ATG

 

gcctgaagatcgctcccattcaatggcgcgaacgacgactacgtcagagc

taacgtagcacttcttccggtttaaaaaaaaAGTTGACAAATCATCGGCC

ATCTTGGTTGCTGTAACAGCCTGAAATAAATTAATTATTACGGCGAACCG

GACTACACTACGATTTCATCGCGTAAAgtgagtatacaaattaaacatgt

tgctgcgtcactgttcgcttgctatctactgcttagtttggatgaagcgg

ggctcgtttcgagctcgtggtccaataaaagttttcatccaatggatgat

tgttttggaggatgaacataggcgccatttccctcctcgctctctgaagc

gcttattggtggctagtggaagggaatggaggcggtcgggaagctgtgtt

acaccggtcgccattttggctctctgatgtaaatgacttctattggctag

ctggttcgttttgagcctaaatggtggcagtttcttaactaccagaaccc

ttagaaaccttgattggtggaatctagtccgaggtttgattggtctgaag

gacagatccaaacgtagtctttattggttagactgcctttacaccgcttt

acaaatattttaggaaaactcgctcaaagcctcctaaaacatcattatat

cacttctcctaatttgatgggaatcgctgtcgatgcggcctaacgttagt

gccgtggcgagcactgtctcctacatttatgccgctttttcacagtcttc

atctcgtcatacagtcttagcagctgatgtctgaagat

hi962 (3-5)

gtaattctttctgacaattaaaattcagtcgtgcattacatgttacatac

ataa

hi2019 (3-5)

caatgttacacgcagcataccgaatgtttgtatggtttcggttagcatgt

ctcccggttaccctgcaaatcctttgttgactttttcccaatcgaaacag

ctttgctatctatagcattataatgtgtcttcttgtttctcagtgtcata

aactatataattatcggtgtatttgttatatccgcatgtttatttcgcag

aatgtgccattgctgtcgtatagtgcagacataaatacaggatttttttc

actgaatgtggggggatacaaacgccataattattatatttaaatattta

acaaacgctgtaatttactgcgtaaatgacacggttttaatgtgccaggt

taaatggaggtcaatttcttgtaacattacatgaacttaatatttgcaat

actcacaacgatcaacgagactttcaagtcaacagtacaaacaaaatagt

tttttcaccttgagtttactagaaacaaggaccttcgtcatctgttgcca

taatctttcagccctgttgctgtaaataattgacctgccttctagctgca

tttcaacaacaaaaagtattgcactgtagtttgagttttagttttgtgtt

ggtttttatctaaaccttttgttgatctctcatttagatgtttttatctc

atgctagtacaagtgtgtgtccttactaggtatttcagcagagttgtcaa

aaaaaaaaaaaagaaaagattaatgtcaagttttgtgtacggactaggca

catgccggtgttttattgtgacattatgataaccttggatcaaactatca

cggtttcgtagtattttgattattgctctcaatatagaacccttaataaa

acctttttcctctttgaacacaatatattttattttaagaaacatttata

atattttggagcagtaaacatgtcaggctaaataattcaaattaattatt

gacttctgtcttcattagtttcaaaaacacacatttctatacaatttaaa

acgacatctttggatgttttcatcaggagatactgttgtcataaaaacaa

aaatgaaacataaataaaaaattttacacataacttaggaacggtatagc

agaacattatggaggttttaaaaccaaaccccagtataccttaaaatggt

tatcgtcccatacctagtacagacaaggtttttgaaatgataatcataat

tatgacccttttttatgctctcatgtaaacaactaaaagcactatattct

gcacttaggtcattgtagatcttactttagaaaggaaaatgagatttctg

tagggctgtgcgattaatcgaatcgcaatcgcaatttgaaacgttgcaat

tagctaatcgcaagaggctgcaatatgaaatgcatttgaactatttaatt

tcccctgcccagagcaaatgtgtgactgccgtctgtgtgatggtcttact

agcttattgagtgagcacaattgagtgatgagtgtcttgctgaaagtatt

gccagtgactcaatttattagcaggcaacagcaaagtaaaatttcagagt

tgtttcagccattgtagtttgctaagggttctgtattattataattatta

tacattttttgtttgtataataagctacactatctccctaatttgagttc

aacttactgaaaggtaaggtcattttattggtgattactgtttgctctag

agaaaaattagtgtttcatttctgaatatttaaaagaccaatttgattaa

atgttgcagtattttttcagttcctttttttaactaacgctcactgcatt

tttagcagtaagaagctacgatacagattattgagctgatgcttgactac

aaaactaaatcaaatcgaaatcgcaatatctgttaaaaacaatatcgcaa

ttagatattttcctaaaatcgcacatccctagatgtctgtttacattatt

atactatggtcggttgttgtcattttgtttaacaggaactcgcacatgcc

tatagacatgcatgtgcaatggtctcacttttataaaagtatgctttaaa

ttttttctcatagaaaagaacgatattgtttttcaaaacttgcactggaa

aacccattttcaaggccaccaaatgctattgtcaagtatatgaatgaaaa

aaatatagagctatagtccattttaatgtggtcatgccactggtccatga

acatttcatgcttatcaaactatttcataactgtaacaagaggcaattta

atcataacctaatgttatcagttgtcataacgttatttatcaatatgtgg

ctattttcagattctcgaaa

(approx 12 kb to first coding exon)