nodal-related 1

cDNA: Genbank AF056327

 

hi975 is in the 2nd exon

 

ggagtcgatcgaggagagaatagggttttacacctcctgacgcacaaaag

aacgctggtttcgatacacgacggcccaccaacatgtatgcctttatgga

tcacaggggccacttcaaagacccaaaacgacctcactgaccatcaaaag

actgcaagtttctataagtgaacttagatgaccggccagcactcatgaca

ttcactttccagaggacggtgtaagagaaagagctcagagaCTTTATTTC

AATAACTGCGTGTGGATTATTACCTTGATTTGACATGTTTTCCTGCGGGC

TCCTGAGCGTAGTTTTGGCCCTCGCGGTCGGCCTGGTGAGCTGCACGGGA

AACCTTGCTGGATTTCAAGAGACCCTCAGGAATAAAATGCGAGCAGCTGG

CAGAAACGGCGGAGGTCGGGCAGGTCACGGCCGACATCTGACCAGATATC

CGCTGTATATGATGCACCTCTACCGGACACTTCTGACTGGAGACGAAAAA

CACTTCAGCCATGAGAATCCAACTCTTTACGAGTCTGACTCCGTCTTGAG

CCTCGTCGCTAAAAgtaagtacaattgatttttttattaataattttcat

atttttttatttacatagcttgaatatattgtttttctcctcatagtagg

ctaaatgtaaacaacttcagtttacctcatcgtgaagtaggctttatgaa

ttaattaacgtagatcgcgtgtacttcacaagtaaatgtatctacattca

agcaaataatttaagttcaaaccaatagggcctagacgcctgtaccctgg

attggttaagcttggataagccaacgggaaccggggtattagccaataaa

caaaccttgccgccagtcattatctaaaaaacaaatctctttcgggttga

tacaagacccttagtgagcattatttgtagtttagctggttctggtctat

tagccaagtcatgtattatgcttattagtgtgtgtgtgtgtgtgtattac

ctttaagacgtctgtttcaaagtggcctgggcatcaatacacatttagac

aataagaacgttctactttattaattgcttgtcccgaacgtggccatgtg

tgaagacatcctttaaagataattaagcaccacacatcacttatcttttc

tagactgtttacctgtctgccctaaacacttttttcttaaatatttttta

ttcagGTTGTCATCAGGTTGGTGACAAATTCGCAGTGACATTTGACATGT

CCTCCATATCAGCAAGCGATGACGTCCAGCGAGCTGAACTTCGCATTCGG

CTTCCGCATCTCAGGTCTGAGTTGGAGGTGGATATTTATCACGCATCTAC

ACCGGAGTGTGAGAGAAGCCCCTGCGAAGAAGTCCGGGTCCACCTGGGAA

CCTTGA

hi975 (3-5)

ACGCCAACCCGATTAACTCAACCTTCCGCTCCTCTTGGAGGATCTTCAAC

ATCACTGCGCTCCTCAAGTACTGGTTGCACCAGAGTGAGCGTGTGCCGTT

TGAGGAACCCACACAGATGCCGCCAATGGCTGAGGGACACAAGAGCGTTC

ATCATCCTACAGCGAACCGAGTGATGATGGTGGTTTACTCCAAGCAGAAC

CGGGCAAAGACGTCCACTCTCATCCGGACTGCCGAGCACTCCAAGTATGT

AGCTCTGGATCGGGCTGGTGGTGGAAGTGAACCTGTGCCTCGGCGCCACA

GAAGGAACCACAGAACTGATGATAGGGTCCGCGATGCAGCAGCAGGGATG

ATTCCTGGTGTTTCCCATGAAGGTGGAGAGAAGAAACCTCTCTGCAAGAA

GGTGGATATGTGGGTGGACTTTGATCAGATTGGTTGGAGCGACTGGATTG

TTTATCCAAAGCGTTACAACGCTTATCGGTGTGAAGGCAGTTGTCCCACA

CCAGTAGATGAAACCTTCACTCCAACAAACCATGCATACATGCAGgtaag

aatctctcagatct