FLJ22611-like

cDNA: Genbank AF506236

 

hi994 is in the 1st intron

 

acagtaggttacatttcagggaccactggcccttaatctatcttgtataa

aagaaaatacaagtaagaacaattcatacatattccaaatgctctcctaa

caccacgatcagacatagttgtagtttttaaaacaatcctcatattcaga

gtcactaattttcgatgcttgtgctaaatttagttcatttttcccaggga

tgacgaatagttggccaaccaTTTCATGTTCCTGTGGAGTCCGGAAGCCA

GTAGTGTCCCGTGTTGCAAATCGGAATTTATAAACAGgtcagatttttaa

tcagtctggtagtaaacctgttcaaacgtgccatttgatgtagctgaggt

tataaatgtttttaaacgacgtcgtgtccgtgtagtag

hi994 (5-3)

taatgcgtctcagccggcgtccatgtgtacgtgaacacacgtgggtctcc

gagcagcacttctagcactgaagctaacacatgcttgtcagattcgtgta

aaatatatatccgcgtacatttaatgttgttgaaggacaagtgttttgtt

gacttgctggttttatgcagatatttagtgttgcggatggtctggcgttg

ttggtttttattgggtgctttagcttttcagttagcatagtgtcaattca

ctgtggtgttgttaatgtgttaaatcggatgagtttatgttttttagaat

tgtttttatggatttgaggacacaaatctctgtctaggactaatgtggtg

ttgtcaaacagtctccatttcaactacatgcttttgtgcaaatatgcaaa

caaacaaacagataaaaatgttattgttatactagtatgtcaaaatattt

gtcctcgaatactcgtaaaataatctgacagtgaccaaactaaacgttat

gtttatgtcatattactttgctttgtaaacagagatcatgtattttatgg

ccacgttatacatgtaaacatcactttcgagggactgtagtgtatgtacg

ttatactgttttaaattggtctcatataagctgttcaagtgtgtcacgaa

agctctagagcatttgtttgtaagtttgattagcatttatggtggttgaa

catattaaataaagttaagtaaataattaagttggttttatatttgcata

ttctgaaatgttccttaatataatttcagaaaagtattattaaattctga

ataggaaaatcagattagcagccaataacttttaaaatacatcattgttt

acattcaattaaatagttttcatgttgttttaaagtcatacctgcatgcg

atttcagatagaatattcaaagtacttagctgggtaaacaattaggggcc

agttatatagagtatataagttattataacacatattaatatgtgaaaat

aaaaccaactttacctcagtgttgaacatatgatgagaacaatattgtgg

attgttaatctttgtttttttttatgttttttggagagtaagtaaaatac

atttgtgtttagttcctagtcttttttttctttagcttttatatatactg

cataaaataattataataaatgtagagttcccaaataaatctgcagatgt

ttttgtatcatgcagactatttcagcaagatatagtaaatatatgcatca

tgcgttatttttgttgaatattcttatagtgattttgtttgtgattataa

catgtctcttgacaaattttatttatgtttattaatgtaataatcataat

tagataatcaattatcttataggctaataaaaactgtgaaggtgcaaaca

ttgagaaaacacaatggtcagcataacagcaggtttaaatgtagtacgac

cccatttgattggccaaatttggataaacaacttatttatgcaacacaaa

atcttggcgcatatgctattattttgataatgataaatctacaataaatt

gggcagccctgttgctgaaaaaagcgtgtaagctttgtcatactcttaag

aggactaaagtgaaagcatttaagtgctcactgtaattcattacataata

ccattactttaacttgctctcgaaatgtgttcattaaaaatatataaagg

tgtattgtagtttctttttatatgttatttctacttctcacaatcatttg

taattacagattcaagtaaagaaaaaaatttaagcatttgcgatttttaa

ggctgttgagtttacagtgggctttaaatgacgcgtgtatagtgtgcaat

gatgtgaaaatagttaataataaatcatgaattgatttaggatttaaaat

gttttactttgcaaaaattttaaaataaaacattgttattaatattattt

ttgaataagataaaatattagtgggcggcgtgtgggtttcctctgggtgc

tccggtttccctcacacaagtttaaagacatgtgctactacaggtgaatt

gggtaatctaaattgttcatagtgtgtgtgaatgagtgtatgggtgcttc

ctagtgatgggttgctgctggaagggcatctgctgcgtaaaacgtgctgg

ataagtttgtggttcattccgctgtgacgacccctaattaataaagggac

taagtcaaaaagaaaattaatgaatgaataaaatatcagtcagtcaatca

ataaggaatagatatttatgcttattattctatttaatattaattataat

ttataaatgttcaaaaagcatcaaaacaataaatatgcagcaaaaacatt

tttgttgcattaaaatgtttaatttttatcatacacatttattttaattt

atacatttatttatttggcaagtttacaacaaggaaactgaatatttagc

aacacaacaaatcactaattgagaattaaagtgtattcccaaaatccaaa

tttaattgtaattttccaaacaggtgtcatacattcaaaaaaacaccaaa

aaaagaggatttttgctgcttgttcaaactacttatttaaaataagatga

ataaacacaattcttatggggtacacctaattgttttatgttcagttcat

ttaaatttgtaaaaataattaggttaacttgcggttgggatattttatta

ggaattttgtggcagtggcgcccaatattttaacagtgtatcccagttgt

tagcaaaatgtaaacactaaaaaaagtgtaaatgatgaacaatcagagca

aagttgaaattagatcaacaaaatgtctataataataattacagtaaacc

tcatactctgtaaacaaaaaaatataataataaaacctgagctttcaagt

aaagtaactaaccaccattattcaaatgcatattgcaacaatgccaattg

tgaagttgaataactacgatacccctatgctaaaaaaaaatctttcagat

agggagctagtggctgggatgcacaagataagaaatcaaaaagccactct

ggcgacatcattacatctgtttttacttacaatctcctcactgttgctag

acactttttgcacaatttttgtgtgtgttgttgttgtgacctgaggtggc

gatgtcgtatttgggttcacatattgtgtctaaaagcatgtgaaaagtgt

gaggcgcgtagattccttcactatttttaatgcgatttgcacttgtgctt

ccctggcatctctcgatgacattctggaaaattgagatgttttcaactag

gtgcacctggaaaatgcgagtgcgtcatgtgttcaccactttctaaccat

gtgtgcgtcgctccctatttttgtgcgcaagctgtggaaataaccctaag

cttattgggattccttccaaggtgtgcgctcaacagacacatttgataaa

actatggccttcataccaaactttttttattgacgataaaattgtaaata

aagatttttttattgacaatagtgttcggtccgtaaatactgataccgtt

ttattgacccagccttatttaataatttaaaaagatttagaatggtttct

tttgtttttatattacgtatgttttgcaggtcagactaaataacctatat

ggttatttaaaacacttaagtagacatttctttacatttaatatacttat

gtacatagtatcatatttgtaaatgtaacttgatgcaagaagcaccaaaa

tgggatacctagttttgacctatactaaacgttacggcctctaaataact

cacgatcatgtttgttttccatttagGGCTCTCCTTGAGATGTTCTCAGG

GTTTCAGGAACGGTACGACCATGAGGACGAGCTGTACAGGGATGAAGAAG

ACTCATCAGGTTTGTCTGATTCGGACAGCGAGTTGGAATTCCGGCTTTAT

TCCCAGCTGCACTACAACGCAGAGTTCCAGGAAAACCATGAGGAATCAAG

CAAAGTCCAACCATTGGTCCCACAAACTCAACTTCAGCCGGAAACCATGC

CTCCTGCTCCACCTGTAGATGTTATCGTGATTGACTCAGGGCCAGATTCT

TTTACAGTGTCAGACAGCACAGAGGATGATGAGAGTGTGTGTGCTAATAA

AGTTCAGTCATTAAAACATTGTAAAAGGAAGTCACAGCCCAGTCGCTTCC

GTTCACCTTCTCCGCCTCAGGTTCAAGCAGGAAGGAGCTCTCCAGATGAT

GTTGTGGTGCTGGATTCTGATTTAGAACAATCCTCTTCTGAATCTGAACC

TCCTTTTGTGGAGGATTTGGACTCGGATACAGACTCTGATTCAGACTCTG

ATGGACTGGAGAACTGGATGATTCTGGGCAAGGGGAGACAAGATGAAGAT

CAGAGCATCCAGCTGAACCTCGCGCAGAGTAGTTTTGTGAATACAGgtaa

ggattttaaa