CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) phosphatase, subunit 1

cDNA: Genbank AY648724

 

hi998 is in the 1st coding exon

 

aagcagcagtttgactgtaactgtttcaccagtttgactttaaatgtttc

atttatttcttacgggttttttatatttagccaaatatttatgcgcataa

atgttgtcattattttattacaaactaaaacagaatactgtagggtaacg

acagatttttttttaaagagggttattaaagtctcccggaagtggataga

gtgtcgctcgtgctgcagccttgtgtttcctgtttacgggcgggaagagt

gaacctgcgtctcagcctgtcctgcaacagagctcatttttatcacttca

tttccctgcgcgcctctggattattttcagagctatttactacttttatt

aactctccccaagcgcttcctgcggctctctgactgaagtttgaagccct

gATGGAGGAGCCTGCAGACTCCGGCGGCGGTGCGGCAGCAGAGGGCCCCG

TGGTGCAGGTGACGGAGATCCGCTGCCCCGCAGGAGCGCGTCCCCTGCGG

CTGCTCGAGTGGAAGGTGAAACCCGGAGCTCTGGTCAACGTTGACTCCGT

GATCGCGGTATGTGCGCCGATCCCCGCCGAAAGCGAGTCCAGAGCGCCCG

AAAAGAAGCTCAAGTCGGACCGCGCTGGAGTTG

hi998 (5-3)

TGCAGGAACTGTGCTGTCAGCTCGGGCAGGTCATCGCGCCTGGgtaagac

acgctctcatgacctcgttgatatcccagatttcacggctgacatttacg

cttttatttccagcctttgcttctgagctgagcgtgctcgcgctaagcta

aagtggcacgcgcactggcgctcacgctgagctcgtgacagcagcatctc

aacttccacgcgcccggtgtaaacatgtttaatatcatgtaaaggtgttt

tacgggattgttgttataccaggcataaaattttcgtattaactgagaaa

taggactgaattatatcttgggagataagctctgataacccctaaactct

gagtgtacatagcaaaacaagagttgggggagcggcccgccctttttagc

caatcagaagcgttctctctctgtcagtcatttagtgcgttgtagtttgg

tgcattcgtattggttggtacggttgtagagggcggagatttggagtgag

ggtgtgtcgttgaaagcatggaggcggtctgaataattcagagaactc