Solution to Knit Square

Puzzlers are presented with a knitted rectangle, like so:

Orienting the square right-side-up and top-side-top (having a knitter around is helpful here), you can observe that the square is not knit in straight stockinette stitch, but instead has a number of backwards stitches (purl bumps). Knit stitches look like a “v“, purl stitches look like an inverted “u”.

Ignoring the garter stitch border (again, a knitter may be helpful here) and interpreting the knit stitches as 0 and the purl bumps as 1, the solver obtains:

01101101 01100001
01101011 01100101
00100000 01101101
01100101 00100000
01100001 00100000
01110011 01110100
01110010 01100001
01101110 01100100

Or, translated to ASCII, “MAKE ME A STRAND”.

To make a knitted object a strand, you unravel it. The solver gathers up his or her courage to do so, and reveals that the yarn is marked with dots and dashes. These are Morse code (solver should interpret the cast on edge as the beginning) for A, C, G, and U.

This gives: AUGGGGUUGGCCGACUGGGAGCUUCUAUGA

This is an RNA strand. Splitting it up into codons and finding the appropriate amino acid, plus its single letter abbreviation, gives:

AUG	start codon
GGG	glycine	G
UUG	leucine	L
GCC	alanine	A
GAC	aspartic acid	D
UGG	tryptophan	W
GAG	glutamic acid	E
CUU	leucine	L
CUA	leucine	L
UGA	stop codon

GLADWELL is the answer.

This puzzle was inspired by an old steganography story about spies smuggling messages past borders by hiding messages knit up in their sweaters. As far as the author can tell, this has no basis in historical fact, even if it is dreadfully romantic. We didn't have time to knit a sweater for each team, so we made do with a small knitted square.

If you want to knit your own puzzle, the pattern follows: