The body of the puzzle is written as a “pesterlog” from the multimedia webcomic Homestuck. Hopefully, if you were not aware of this comic, the Warhammer of Zillyhoo reference should lead you to it swiftly.
In Homestuck, each of the main characters has a particular way of typing. Eridan Ampora, for instance, always doubles ws and vs. From these typing quirks, the character delivering each line in the puzzle can be determined.
Each character has a conjoined two-word chat handle, such as
Eridan’s being caligulasAquarium. Each line of chat
is prefaced by the initials of the chat handle, so Eridan’s lines
would all start CA:. In the puzzle, these
designations are blacked out. After determining which character
delivers each line, the handle initials can be filled in.
A significant aspect of Homestuck is genetic codes. Each of the main character’s handles have initials from the nucleotide bases ATCG. If the chat handle initials from the whole puzzle are put in sequence, the following genetic sequence is recovered:
CCAGCCGGCGAGGCCGATGACCGAGAGAGCAGCGAGAGCTGGCATGAGCGGGAGGATGAGGCCGATATCTCGATCAATGCGCCGGCGAATGAATTG
If this is split into triplets and decoded to an amino acid
sequence, using the standard
single-letter
abbreviations for amino acids, a message is recovered:
PAGE ADDRESSES WHERE DEAD IS IN A PANEL.
Characters die quite often in Homestuck (the same character multiple times, in some cases), but in a few select instances those deaths are accompanied by panel art with the word “DEAD” in them. All ten of the characters featured in the puzzle’s dialog have had this happen in at least one instance. Homestuck is arranged on the web so that each page has a (usually) four-digit page address. The relevant DEAD panels are found at:
| Character | Page address |
|---|---|
| Tavros Nitram | 5199 |
| Feferi Peixes | 5233 |
| Kanaya Maryam | 5247 |
| Equius Zahhak | 5348 |
| Eridan Ampora | 5437 |
| Vriska Serket | 5763 |
| Jade Harley | 6007 or 8551 |
| Roxy Lalonde | 7086 |
| Karkat Vantas | 8231 |
| Terezi Pyrope | 9085 |
The chat lines given in the puzzle are all exactly 100 characters
long, including spaces and punctuation. These page addresses can
be used as a set of two indices to extract two characters from
each line, according to the character who delivered them. In the
case of Jade, using either of the addresses extracts the same
characters. After extracting all the characters, one finds twelve
space-separated strings: seag0at Lion S)(-ELLFIS)( HOLST31NS
bowwhunter M41D3N Twins sCALES PITCHER 4R4CHN1D BiGhOrN FISH
Each of these strings describes one of the zodiac signs, written in the style of one of the Homestuck trolls. Since each troll additionally is associated with a specific zodiac sign, it’s possible to pair the troll with the appropriate zodiac sign with the troll whose typing style is represented. This yields a single letter in the same position in both names:
| Word | Zodiac | Zodiac troll | Typing troll |
|---|---|---|---|
seag0at |
Capricorn | G A M Z E E M A K A R A | A R A D I A M E G I D O |
Lion |
Leo | N E P E T A L E I J O N | K A N A Y A M A R Y A M |
S)(-ELLFIS)( |
Cancer | K A R K A T V A N T A S | F E F E R I P E I X E S |
HOLST31NS |
Taurus | T A V R O S N I T R A M | T E R E Z I P Y R O P E |
bowwhunter |
Sagittarius | E Q U I U S Z A H H A K | E R I D A N A M P O R A |
M41D3N |
Virgo | K A N A Y A M A R Y A M | T E R E Z I P Y R O P E |
Twins |
Gemini | S O L L U X C A P T O R | K A N A Y A M A R Y A M |
sCALES |
Libra | T E R E Z I P Y R O P E | T A V R O S N I T R A M |
PITCHER |
Aquarius | E R I D A N A M P O R A | K A R K A T V A N T A S |
4R4CHN1D |
Scorpio | V R I S K A S E R K E T | T E R E Z I P Y R O P E |
BiGhOrN |
Aries | A R A D I A M E G I D O | G A M Z E E M A K A R A |
FISH |
Pisces | F E F E R I P E I X E S | K A R K A T V A N T A S |
Taking the letters in order gives the final answer, MASTER
AT ARMS.