Sharp Lab
research icon
All UTR inserts were constructed in the following format:
TCTAGACTCGAGCCGG[binding site]ATCGCGGGCCC

The binding site, shown in bold, is a unit that is repeated a given number of times for a construct.

For more details on the cloning, click here .

Binding Sites
CXCR4 sense BULGED
AAGTTTTCACAAAGCTAACACCGG

CXCR4 sense PERFECT
AAGTTTTCACTCCAGCTAACACCGG

GFP3 anti BULGED
AGGTGCGCTCCAAACGTAGCCTCCGG

GFP3 sense BULGED
TGGGGCTACGAAAGGAGCGCACCGG

CXCR4 anti BULGED
TGTGTTAGCTTCGTGAAAACCCGG

A binding site is named "sense" if it binds to the antisense strand of a siRNA, and "anti" if it binds to the sense strand of a siRNA.
BULGED indicates that the siRNA:mRNA pairing produces a bulge, while PERFECT indicates that the siRNA shares perfect complementarity to the target mRNA.

  siRNAs (sense strand is shown on top, antisense on the bottom) CXCR4 siRNA

GFP siRNA

GFP siRNA, with mutations

MIT
Last updated Dec. 22nd, 2008