| return to gene table | |
Drosha |
|
| Target gene: Drosha NM_026799 |
Probe type: shRNA |
| Sequence: GATCCCCCAACAGTCATAGA ATATGATTCAAGAGATCATA TTCTATGACTGTTGTTTTTGGAAC |
NCBI Database ID#: not submitted |
| Target sequence: TCATATTCTATGACT GTTG |
|
| Comments: shRNA vector is currently available from Addgene. |
|
Publications |
|
| Kumar MS, Lu J, Mercer KL, Golub TR, Jacks T. 2007. Impaired microRNA processing enhances cellular transformation and tumorigenesis. Nat Genet. 39:673 | |
Validation Experiments |
|
| Organism: Mouse |
Experiment subject: Cell culture |
| Cell type: Lung adenocarcinoma |
Cell line: LKR13 |
| Gene of origin: Endogenous |
Treatment prior to RNAi: |
| Vector: pSuper.retro.puro |
Delivery method: Virus infection |
| mRNA suppression (%): 80% |
Method of mRNA detection: real-time PCR |
| Protein suppression (%): N/A |
Method of protein suppression: N/A |
| Phenotype observed: | |
| Notes: |
|
Submitters Information |
|
| Submitted by: Madhu Kumar |
Location KI |
| Lab Tyler Jacks |
|
Last updated May 15th, 2008