return to gene table |
CD82 - KAI1
|
Target gene:
CD82 (NM_002231) |
Probe type:
siRNA |
Sense sequence:
GGGTTCTCTTATCAACTCATT |
NCBI Database ID#:
8810129 |
Anti-sense sequence:
TGAGTTGATAAGAGAACCCTG |
|
Comments: |
|
|
|
Publications |
|
Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Multiplexing siRNAs to compress RNAi-based screen size in human cells. 2007. Nucleic Acids Res. 35:e57 |
|
Validation Experiments |
|
Organism:
Human |
Experiment subject:
Cell culture |
Cell type:
Breast cancer |
Cell line:
MDA-MB-231 |
Gene of origin:
Endogenous |
Treatment prior to RNAi:
N/A |
Vector:
N/A |
Delivery method:
siLentfect |
mRNA suppression (%):
89% |
Method of mRNA detection:
Branched-DNA assay |
Protein suppression (%):
not tested |
Method of protein suppression:
N/A |
Phenotype observed: |
Notes:
|
|
Submitters Information |
|
Submitted by:
Natasha Caplen |
Location
National Cancer Institute |
|
|
|