| return to gene table | |
MET
|
|
| Target gene: MET (NM_000245) |
Probe type: siRNA |
| Sense sequence: CGAGGGAATCATCATGAAATT |
NCBI Database ID#: 8810143 |
Anti-sense sequence: |
|
| Comments: | |
| SNP in nucleotide 17 (T/C) | |
Publications |
|
| Martin SE, Jones TL, Thomas CL, Lorenzi PL, Nguyen DA, Runfola T, Gunsior M, Weinstein JN, Goldsmith PK, Lader E, Huppi K, Caplen NJ. Multiplexing siRNAs to compress RNAi-based screen size in human cells. 2007. Nucleic Acids Res. 35:e57 | |
Validation Experiments |
|
| Organism: Human |
Experiment subject: Cell culture |
| Cell type: Breast cancer |
Cell line: MDA-MB-231 |
| Gene of origin: Endogenous |
Treatment prior to RNAi: N/A |
| Vector: N/A |
Delivery method: siLentfect |
| mRNA suppression (%): 78% |
Method of mRNA detection: Branched-DNA assay |
| Protein suppression (%): 93% |
Method of protein suppression: Multi-array ECL |
| Phenotype observed: | |
| Notes: |
|
Submitters Information |
|
| Submitted by: Natasha Caplen |
Location National Cancer Institute |
Last updated January 9th, 2009