DNA Sequencing
General Information
We use the Applied Biosystems Model 3730 capillary DNA sequencer with Big Dye Terminator Cycle Sequencing Kit. Maximum read lengths are approximately 1000 bases. The sequence is readable about 30–50 bases downstream of the primer sequence. We anneal at 50°C and extend at 60°C so make your primer melting point (Tm) ca. 55°C. You may want to do a Google search for “Oligo Molecular Weight Calculator” to find web pages that will calculate Tm quickly.
Primer Considerations
- High Purity
- Appropriate concentration
- No mismatches
- No alternative hybridization sites in template (false priming)
- No palindromic sequence present, particularly at the 3’ end of primer
- Appropriate length to give Tm of ~55-60°C. (generally 20-24 bases)
- GC "clamp" on the 3' end
- Desirable [GC] = ~50-55%
- Avoid strings of four or more of same the base if possible
- Avoid low Tm (i.e. 40-45°C.) If Tm is low, make the primer longer.
Template Primer Quantity Table
Recommended template and primer requirements for 12 ul sample
Template |
Quantity |
|
|
PCR products: |
|
100-200 bp |
1-3 ng |
200-500 bp |
3-10 ng |
500-1000 bp |
5-20 ng |
1000-2000 bp |
10-40 ng |
>2000 bp |
20-50 ng |
Single-stranded DNA |
25-50 ng |
Double-stranded DNA |
150-300 ng |
Large DNA BACs, PACs, YACs, cosmids, fosmids
(Large DNA is considered to be 30,000bp or above insert size.)
|
0.5-1.0 ug (use 5-10 pmoles of primer) |
Bacterial genomic DNA |
2-3 ug (use 6-13 pmoles of primer) |
|
|
Primer |
3.2 pmol (unless noted above) |
Template Preparation for Successful Automated DNA Sequencing
Pure DNA should give an OD260/280 of between 1.7-1.9 (1.5-1.7 is usually OK) and an OD200/260 of about 1.1. Low 260/280 indicates protein contamination, high OD260/280 indicates possible RNA or residual organics contamination. High OD200/260 indicates contamination by organics and/or salts.
Commercial Methods for Template Preparation
In addition to the Applied Biosystems Sequencing Chemistry Guide, also see Qiagen’s web page for DNA purification products. Qiagen has an excellent DNA Template Preparation Guide and Troubleshooting publication. Your final purification step should be a column spin using water. Substitute water for “elution” buffer to obtain reproducible results. Elution buffer components (e.g. tris, NaCl, EDTA) cause run failures unless diluted out. Also see "ExoSAP-IT" from USB Corporation for PCR product cleanup.
Ensuring Template Quality
The quality of DNA in a reaction affects the performance of the DNA Analyzer. When preparing DNA templates, it is critical to avoid the following:
- Residual salts
- Proteins
- Residual detergents
- Residual RNA
The presence of residual salts, proteins, RNA, and detergents can interfere with capillary electrophoresis and electrokinetic injection. Your current template purification methods may have to be modified to remove residual salts, proteins, and detergents.
Effect of Residual Salts
The 3730 DNA Analyzer is especially susceptible to salt in samples from template preparation. The negative ions in salts can be preferentially injected into the capillary array during electrokinetic injection, leading to lower signal. In addition, the negative ions compete and interfere with the injection of larger DNA extension fragments, leading to shortened read lengths. If salts and unincorporated dyes are not removed from the
sequencing reaction, they will compete with extension fragments during electrokinetic injection and result in weak signals.
Effect of Proteins
Many DNA preparation methods for sequencing require the recovery of DNA from lysed bacterial cultures. Unless DNA is carefully purified, protein can remain in the DNA samples. Protein can be injected and adhere to the walls of the capillary array adversely affecting data resolution.
Effect of Residual Detergents
Some methods of template preparation, such as the Thermomax method for M13 preparation, use detergents such as Triton X-100 to lyse the protein coat of phage particles. Other detergents, such as sodium dodecyl sulfate (SDS), are used in plasmid purification protocols to lyse bacterial cells. Small, negatively charged detergents may be preferentially injected over DNA during electrokinetic injection. If present at high levels, detergents such as Triton X-100 and SDS will adversely affect the life of the capillary array and the quality of the sequencing data.
Effect of Residual RNA
Residual RNA that is present in DNA template preps competes with the DNA for injection into the capillary array. Residual RNA has the same effect as excess salt, that is, decreased signal and shortened read lengths.
Template Quantity
Effect of Too Little Template
Too little template or primer reduces the signal strength and peak height. In the worst case, the signal-to-noise level decreases so that bases cannot be called.
Effect of Excess Template
Excess template can affect data quality when present in sample loading onto the DNA Analyzer. Excess template inhibits the injection of extension fragments thus affecting signals generated from the instrument. Excess template can behave similarly to proteins and accumulate in the capillary array, which affects data resolution. (Applied Biosystems 3730/3720xl DNA Analyzers Sequencing Chemistry Guide, p.18-22).
Host Bacterial Strains
The host strain used for a specific template preparation can impact template quality.
Applied Biosystems reports the following on host strain variability vs. sequencing results
• DH5 alpha host strains consistently produce good results.
• HB101, MV1190, JM109 and XL1 Blue host strains show some variability in result quality. XL1 Blue grows slower than most strains and can lead to decreased DNA yields and it does not respond to TB as do other strains (only showing a 2-3 fold increase in cell number per ml).
• JM101 (JM 100 series) is not recommended.
The following is anecdotal:
Avoid Terrific broth and other rich media
Avoid host strains TG1 and TG2 which contain high carbohydrate levels
Note: Template preparation or purification procedures which involve the use of phenol or chloroform should be avoided if possible. If use of phenol or chloroform can not be avoided an additional ethanol precipitation is recommended.
Some Primer Sequences Used in Fluorescent Sequencing (5’-3’)
Bac Forward TTTTACTGTTTTCGTAACAGTTTT
Bac Reverse CGGATTTCCTTGAAGAGAGTA
Bac(+15) Reverse ACTTCAAGGAGAATTTCC
Bac1 ACCATCTCGCAAATAAATAAG
Bac2 ACAACGCACAGAATCTAGCG
BacMam 3' TCCCATATGTCCTTCCGAGTGA
BacMam 5' ACGTGCTGGTTGTTGTGCTGTCT
BGH Reverse TAGAAGGCACAGTCGAGG
BK Reverse ACAGGAAACAGCTATGACCTTG
Blue2S ACCGCTGCTGCTAAATTCGAA
Bluescript KS TCGAGGTCGACGGTATC
Bluescript SK CGCTCTAGAACTAGTGGATC
CBDcenA TCAACGGCACCACCTGCA
CBDcexLEAD TAGGTGCAACTGTTGTTCTG
CBDclos CAACACCAGTTGTAAATCCA
EBV Reverse GTGGTTTGTCCAAACTCATC
M13 Forward (-20) GTAAAACGACGGCCAGTG
M13 Forward (-41) GGTTTTCCCAGTCACGAC
M13 Reverse (-27) GGAAACAGCTATGACCATG
M13 Reverse (-48) AGCGGATAACAATTTCACAC
pCDM8 Reverse TAAGGTTCCTTCACAAAG
pCEP Forward AGAGCTCGTTTAGTGAACCG
PCMV Forward CGCAAATGGGCGGTAGGCGTG
pTRE 3' CCACACCTCCCCCTGAAC
pTRE 5' CGCCTGGAGACGCCATCC
pYESTrp Forward GATGTTAACGATACCAGCC
pYESTrp Reverse GCGTGAATGTAAGCGTGAC
SP6 TACGATTTAGGTGACACTATAG
T3 CAATTAACCCTCACTAAAGG
T3 Bluescript AATTAACCCTCACTAAAGGG
T7 GTAATACGACTCACTATAGGG
T7 Promoter pET AAATTAATACGACTCACTATAGGG
T7 Terminator GCTAGTTATTGCTCAGCGG
T7 Terminator pET GCTAGTTATTGCTCAGCGG
Vectors Incompatible with the Above Primers
Vector |
Primer(won’t work) |
Alternate Primer(will work) |
pT7T3 |
T3 |
M13 FWD |
pT7T3 |
T7 |
T7 Promoter |
pSP72 |
T7 |
T7 Promoter |
pcDNA |
T7 |
T7 Promoter |
(back to top)
Cost
See Pricing Chart.
(back to top)
How to Order
We use a laboratory information management system (dnaLIMS) to handle orders and distribute data. Templates are mixed with primers and submitted in 12 ul as described in the Template Primer Quantity Table section. Also see the Sample Submission in Detail section for additional information. Requests are submitted to:
http://dnalims.mit.edu/
First time users must create an account before logging into the LIMS. Once logged in, follow the instructions and call if you have any problems. Your account number must be exactly seven digits with no spaces, dashes etc.
The LIMS asks if the template is “difficult to sequence”. We will use extra polymerase, blend polymerases and / or alter the thermocycling conditions if you select “difficult template” and also indicate the nature of the difficulty (e.g. hairpin or GC rich) next to the samples in question when you fill out the web request form.
Print out 2 copies of your request—one for yourself and one to submit to the lab. Drop off your samples and request forms in the refrigerator at the front of the lab. The file name of your data will consist of your sample name and primer. For example, if your sample name is AB123 and the primer is M13F the electropherogram file name will be AB123-M13F.ab1. Submit samples in 8-strip PCR tubes or 96-well plates. Use only ABI (PN: N8010560) plates which you may obtain from us. Place strips and tubes into 50cc tubes and write the assigned “Order Number” on the tube or plate.
Additional LIMS helpful notes are located below in the dnaLIMS User Notes section.
(back to top)
Sample Submission in Detail
We ask for 12 ul but use only 6 in case we have to repeat an analysis.
If you have any questions about sample preparation for DNA sequencing that are not addressed on this page we suggest that you download the Applied Biosystems DNA Sequencing Chemistry Guide and/or the Qiagen publication: “The QIAGEN Guide to Template Purification and DNA Sequencing, 2nd edition” from their web sites. We will also email these documents to you upon request.
How to Prepare samples for DNA sequencing
Individual tubes
Template and primer should be diluted to 12 ul with water. Submit samples in 8 strip PCR tubes with caps (ie.VWR/MIT Stockroom PN 20170-004) Label tubes 1,2,3 etc. DO NOT try and squeeze your sample name on the tubes. It makes it very difficult to read and can result in a delay if we need to contact you because we cannot read the tubes. Submitting samples in eppendorf vials takes longer to set up so PLEASE USE STRIPS. Group individual tubes/strips into 50 ml Falcon tubes. (we have recycled 50 ml tubes in the lab near the refrigerator) Label with NAME and ORDER NUMBER. Place in refrigerator at front of lab and leave forms in the plastic pocket.
96 well plate(>75 samples)
ONLY use ABI plates (PN: N8010560) which can be obtained from us. Scale down the template and primer requirements by 50% and dilute to 6 ul with water.
To receive the discounted price you MUST follow these instructions for submitting directly in 96 well plates:
- Contact the lab and we will supply you with the correct plate to use. If samples are submitted in plates other than those specified, we will have to transfer the samples into the correct plates, therefore, the price will not be discounted.
- Load the plate vertically NOT horizontally. The instrument picks up vertical columns at one time. When the data is posted it is arranged by vertical wells, A1-H1, B2-H2, C3-H3 etc. If you load horizontally your data will not post in the same order as you see on the request sheet. We cannot change the order in which data posts.
- You MUST use only 6ul if directly loading a well plate. If you use 12ul we will have to transfer 6ul of all the samples to another plate defeating the whole purpose of submitting it in the plate, and therefore, the price will not be discounted.
- Leave A1 and/or H12 empty for our standard. It is preferable to have a standard in one odd well(A1) and one even well(H12). A single standard is OK if you have 95 samples. We can run a plate of 96 samples but please be aware there will be no control sample to verify instrument performance.
- Please Note: An order of fewer than 76 samples will not be eligible for a discounted price. If you have fewer than 76 samples it is preferable to use the 8 strip tubes
(back to top)
Troubleshooting Guide
Frequent Reasons for Failure to Get Good Data
Failure results when there is an insufficient level of fluorescent termination products for the computer software to assign a sequence. Some possible reasons:
1. Our new capillary sequencer (and corresponding new sequencing polymerase kits) provides longer reads but is also more sensitive to residual salt and ethanol in sample.
If you are experiencing variable results(e.g. in silica based purification schemes where 10 mM Tris is the recommended elution buffer), try a post spin-out ethanol PPT or elute in water instead of E.B.
2. Too little template results in reactions with little or no signal and poor or no base calling.
3. Too much DNA producing reactions which terminate prematurely, often with fewer than 250 bases of reliable sequence data.
4. Poor quality template DNA. Template DNA must be free of residual ethanol and salt.
5. Insufficient primer concentration or poor quality.
6. The Tm of the primer is << 50°C.
7. The template does not contain a sequence complementary to the primer.
8. Primer and/or template was not added to the reaction.
9. Using the same primers for sequencing as were used for PCR. One of the primers used to generate the PCR product does not work under fluorescent cycle sequencing reaction conditions.
10. Template from two different colonies was submitted inadvertently. You may have picked the biggest colony or plated too densely in which case many of your colonies are actually two different colonies rather than the one of interest. This results in two overlapping sequences on the electropherogram. The fix is to re-plate at a lower density and re-sequence.
Some Common Mistakes with Qiagen Plasmid Kits which Affect the Sequence Quality
The directions for cell growth are not followed resulting in overloading the Qiagen resin. Usually, a poor yield of plasmid DNA results, presumably due to competition with RNA fragments for binding to the Qiagen resin. Use the recommended quantity of LB broth (don't use Terrificbroth) for cell growth.
The isopropanol-precipitated DNA is not washed with 70% ethanol to remove excess salt. Wash the DNA pellet at least once as directed with 70% ethanol. Residual salt in the final template will interfere with the activity of Taq polymerase resulting in sequence data which extends fewer than 200 bases from the primer and exhibits a low signal to noise ratio.
The template DNA is not dried completely before final resuspension in H2O. To remove residual ethanol, dry the DNA for 5 min. in a properly operating speedvac. If air-drying, make sure that the DNA is dry (no fluid in the tube, the DNA pellet does not look wet). When air drying, a brief 15 min incubation of the open tube at 65 oC is often sufficient to completely dry the DNA. Residual ethanol is detrimental to Taq cycle sequencing resulting in data with a drastically reduced signal.
DNA Sequencing Troubleshooting Table
Observation |
Possible Cause |
Solution |
Poor quality template |
|
|
Weak , noisy signal. Signal strength in raw channel is usually less than 100 |
Contaminated Template:
Template DNA must be free of residual ethanol and salts. And also free of cellular components such as RNA, proteins, polysaccharides, and chromosomal DNA |
Re-precipitate template |
Large stop peaks |
Degraded DNA |
Re-isolate DNA |
Multiple, overlapping peaks |
More than one template present
Double pick of two colonies |
Clean up PCR products
Re-isolate DNA |
Large dye blob at ca. 60 and 100 bases |
Insufficient template |
Increase amount of template |
Primer related problems |
|
|
No sequence generated |
Insufficient template |
Increase amount of template |
|
Contaminant |
Clean up template |
|
Insufficient primer |
Increase amount of primer |
|
Primer has no annealing site
Poor primer design
Incorrect sequence |
Re-design primer |
Noisy data with weak signal |
Not enough DNA |
Use more DNA in reactions |
|
Primer anneals poorly |
Re-design annealing temp |
Noisy data with good signal strength |
Contaminated template |
Clean up template |
|
Multiple templates |
Examine template on agarose gel |
|
Multiple priming sites |
Redesign primer |
|
Multiple primers with PCR products |
Purify PCR template |
|
Too much DNA |
Use less DNA |
Noise up to or after a certain point |
Mixed plasmid prep
Multiple PCR products |
Ensure only one template present |
|
Long homopolymer A or T (slippage) |
1. Use an anchored primer(ie. a sequencing primer that is PolyT containing an A, C or G base at the 3’ end of a polyA region) The 3’ base will anchor the primer into place at the end of the homopolymer region.
2. Sequence from both directions |
(includes data from ABI 3730 Sequencing Chemistry Guide “Appendix B: Troubleshooting”)
(back to top)
Viewing the Sequencing Results
You will be notified by email when the results are ready. Inspect each electropherogram for errors in base calling. Occasionally, there are miscalls that are obvious to the eye but difficult for a computer to recognize. As a rule, when you reach the point where there is one N per 20 bases, the sequence is not usable.
You can view and print the electropherogram (sequencing traces) and text output along with a quality score. Files can be downloaded to your computer. For rapid turnaround, on weekends we may send out raw data without editing. If subsequent editing was needed you will receive a new mailing. Turnaround time is typically 48 hours.
The following web sites offer free programs for viewing electropherograms (.ab1 files):
Pay software to view electropherogram outputs
Your department may have a site license for DNA alignment, searching and manipulation programs such as DNASTAR, Sequencher etc.
(back to top)
dnaLIMS User Notes
Reprinting order requests
If you forgot to print out the order request you cannot get back to that page. You can go to “Display Order Summary” to get a list of all current orders and obtain a printout. Select the order you wish to print. You will get a summary page similar to the original printout.
Deleting an order
To delete an order go to “View your requests” enter the order number you wish to delete and choose the “delete order” radio button. You can only delete orders that have not yet been put into a sample sheet. You would generally use this to delete an order that you have maybe decided not to submit, or had problems with and just want to start fresh. If you have problems contacts us and we can also delete the order for you.
Downloading Sequencing Results
If you are looking in the “Download sequence Results” page and see your order # but it has no data and says ‘There are 0 samples” this means the plate is processing and data will post when done.
If you are using a MAC and download individual files you may see a .txt extension after the .ab1 in the file name for the chromatogram files. The file will not open. You can simply delete the .txt and the file will revert to the .ab1 file which you can now open. To avoid this, choose to download all at once (Button at the top of the page). This will not attach the .txt to the files.
Samples that are ready to download sometimes will not appear in the "Order Number Search" box when you are trying to download your samples. If you think your data should be ready but do not see the order number, use the "Plate Number Search" box and select the plate at the top of the list. You should then be able to see the order and download it. If you think it should be ready but don't see it in either box then contact the lab.
Trouble submitting an order
If you get an error message after submitting an order, such as “database does not exist” or “user ID not found” contact the lab immediately. This indicates a problem with the server.
Results may be listed out of order
Occasionally you may notice the list order of your data is not in the same order as on the request form. This is due to the fact that the software arranges data according to the well # starting with A1-H1, A2-H2, etc. We try to load the plate so you get the data back in the same order as submitted but it is sometimes unavoidable.
(back to top)
|